Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker AA840739

SGN-M5976

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14469)
Chromosome
8
Position
133.55 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34325
Forward primer (5'-3')
CCCTCTCTCTTCCCTTCACC
Accessions and product sizes
Capsicum frutescens BG2814-6
95
Capsicum annuum NuMex-RNaky
95
Approximate temperature
Unknown
Reverse primer (5'-3')
AGTGCTACGATGGCTTAGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Byung-Dong Kim
Organization: Seoul National University
Genomic location of AA840739  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5976 marker 5976
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)