SGN Marker CT245

SGN-M598

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTGTAAAACATATATGGATAACAGAAATCTCTCTGTTGCAAATACACGTGACATAAACATTTTGTATGTTTCCTGAA
TACAAAGATATGAAGGTCAACCTTAAACATGGTTCCCTCTACTGATCACACAAGGTTATAAAGATATGATAACGAGGAGAATTTGACTGA
AAAAGATGAAGAAAATCAGAAATTGACGATGAACATACACAGAAACAATTCCGTATTAACAGCTGTGACTACTTGAACCAAGTAGGCCGG
AACCTCATACAGCAACTGCTGCAGGCCTTTTGCTTGTCTTGATCCCTTTAATAGCTTCAGCATAATCAGGAGCTCCAAAGACAGCAGAAC
CTGCTACCAAGGCATTGGCTCCGGCTTCAATGACCTTGTAAGCATTTTTGGGACCAACTCCACCATCAACTTCAATCCAAGGGTTTACTC
CCTTCTCAGCACATATTTTTCTCAAGTCTGAGATTTTCTTGACCTGACTC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U144013485 (97.0% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53766)
Chromosome
8
Position
52.40 cM
Confidence
uncalculated
Protocol
RFLP

Carotene_content_car8_12_Methylthio_ethanol_content_meo8_1Hex_3_en_1_ol_content_x3o8_1 2_Phenylethanal_content_pea8_1 3_Methylthio_propanal_content_mta8_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51889)
Chromosome
8
Position
89.20 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42963)
Chromosome
8
Position
16.10 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43963
Forward primer (5'-3')
TCCACCACCACCTTATTACCCT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AAACAAAGCCACCCATCTCAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9584)
Chromosome
8
Position
36.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT245 was used as an overgo probe on plate 12 [well D6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P018M01,   P201E04,   P154L10,   P075F12,   P283C09,   P158M18,   P160N12,   P131J19

 Overgo Sequences

A sequence
ATACAGCAACTGCTGCAGGCCTTT
B sequence
GGGATCAAGACAAGCAAAAGGCCT
AB sequence
ATACAGCAACTGCTGCAGGCCTTTTGCTTG
Marker sequence
CTTTTTTTTTTTTTTGTAAAACATATATGGATAACAGAAATCTCTCTGTT
GCAAATACACGTGACATAAACATTTTGTATGTTTCCTGAATACAAAGATA
TGAAGGTCAACCTTAAACATGGTTCCCTCTACTGATCACACAAGGTTATA
AAGATATGATAACGAGGAGAATTTGACTGAAAAAGATGAAGAAAATCAGA
AATTGACGATGAACATACACAGAAACAATTCCGTATTAACAGCTGTGACT
ACTTGAACCAAGTAGGCCGGAACCTCATACAGCAACTGCTGCAGGCCTTT
TGCTTGTCTTGATCCCTTTAATAGCTTCAGCATAATCAGGAGCTCCAAAG
ACAGCAGAACCTGCTACCAAGGCATTGGCTCCGGCTTCAATGACCTTGTA
AGCATTTTTGGGACCAACTCCACCATCAACTTCAATCCAAGGGTTTACTC
CCTTCTCAGCACATATTTTTCTCAAGTCTGAGATTTTCTTGACCTGACTC
Genomic location of CT245  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D598 marker 598
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)