Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG642

SGN-M6

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG642 image not available
Forward sequence
TAGTAACTTCTTGGAGCGCCCCTTTCTGGCTATGTCATCCTCCTTTCAGCAGGGACGTTGCCTTTGAGCTCCTGATTCAACTCTCTAGTT
CGATTAAATAAGCAATTATACTAGTATTTAGTTGTAATCTGTATATGTAGTAGTCAGCACAGTTAAAAGTCTATTTACTAGATTTTTTTC
CATAATTTTCAGAAGATTCTCTTCTAAAGATGTAGAGCGACCCACACCCCTTTTAGGCGGTGTAGTTGGTGTCCTTGCGGGAACAATCGT
ATAGAAGATGACTGTTGTAATTATTAAATTAAACCATAATAAACGTGGAGAAAGATACAACTCTAGTTCTTTATTTTAGTTTTTTTTTCT
TTGTTAGTTGGATGAGCTGATTGCCTGGCCTTTTGGGTCCACAAAAGATATGATAGCTACTTTTGAAGAACATCACTTCTTGAAAAGTTC
AATGTCCAATTTCCTTGGTAGTAGTTCTTGGAGGTAGGGACAATGAAATTTTGAATTTGTAATTTGGAAATTAATAGATCAAACTCAAGA
GTTTTCAACACTTTTAAGTTTGTCCACACTTTTGATCTACGACGTATATATAACAAATTATATCTATCA
Reverse sequence
ACATTCCAATTTCCAACCACTAATATAACAAACATGTACACATACAAAGACAGAGCCTGTGCTGAGTCCCTGATTGTAGAAAAAACATGA
ACCAGTAACAAAAAATACCTGAGCGAGCTTAGCGGGTTATTAGGGAAGTTCTCATCAAGAGATGATTCTTCTGCAAGTATAAAAAAGTCA
AAATCTTTTTTTTCAGCCTTGTCAGTGCATCAAGTCTAGATTTTCAAGTAAGAAAAAAACTATGCAAGAATCAATAACTGTTCGTCTCAA
GTCCAGATTAGTCCAGTGAGTTATCTGATCAGATTTTCAAAACTAGTTTTACCAAACCGTCAACCTACTGCTACACCTCATTTTCTTTTT
TACTGAATTCTGAACACAAACTCAACTAATTTCACGAGATTTCTATCACCTCCTGCAAATAACTCTGTCAGCTAGAACAAATAGGGAGAA
ATCACCTACTATATTTTATCTCGGAATTTGAACCTGACACCTCCTGATTCTCAAAACACACCATACTTTACAAACATACATATCAAAATT
ATGCAAGAAATGTGAAAAAATCACCCCACCCCACAAAAAAAAACAATATGGAAAGATTTTAATATATTGTACCAGTGGAATGGATGATAG
GAGAATGAGGGGATGTAGTATCTCCACCCATAACTGTAAGCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U168108549 (90.1% of RFLP seq)+
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42501)
Chromosome
6
Position
124.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7707)
Chromosome
6
Position
105.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7709)
Chromosome
6
Position
130.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7708)
Chromosome
6
Position
89.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG642 was used as an overgo probe on plate 2 [well H1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P117M16,   P118B22,   P012P06,   P082P15,   P218M11,   P060N22

 Overgo Sequences

A sequence
TTTCAGCAGGGACGTTGCCTTTGA
B sequence
GAGTTGAATCAGGAGCTCAAAGGC
AB sequence
TTTCAGCAGGGACGTTGCCTTTGAGCTCCT
Marker sequence
TAGTAACTTCTTGGAGCGCCCCTTTCTGGCTATGTCATCCTCCTTTCAGC
AGGGACGTTGCCTTTGAGCTCCTGATTCAACTCTCTAGTTCGATTAAATA
AGCAATTATACTAGTATTTAGTTGTAATCTGTATATGTAGTAGTCAGCAC
AGTTAAAAGTCTATTTACTAGATTTTTTTCCATAATTTTCAGAAGATTCT
CTTCTAAAGATGTAGAGCGACCCACACCCCTTTTAGGCGGTGTAGTTGGT
GTCCTTGCGGGAACAATCGTATAGAAGATGACTGTTGTAATTATTAAATT
AAACCATAATAAACGTGGAGAAAGATACAACTCTAGTTCTTTATTTTAGT
TTTTTTTTCTTTGTTAGTTGGATGAGCTGATTGCCTGGCCTTTTGGGTCC
ACAAAAGATATGATAGCTACTTTTGAAGAACATCACTTCTTGAAAAGTTC
AATGTCCAATTTCCTTGGTAGTAGTTCTTGGAGGTAGGGACAATGAAATT
TTGAATTTGTAATTTGGAAATTAATAGATCAAACTCAAGAGTTTTCAACA
CTTTTAAGTTTGTCCACACTTTTGATCTACGACGTATATATAACAAATTA
TATCTATCA
Genomic location of TG642  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6 marker 6
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)