Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker Hpms1-117

SGN-M6002

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41600)
Chromosome
9
Position
30.20 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43568
Forward primer (5'-3')
ACCCAAATTTGCCTTGTTGAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCCATAACCTTATCCCATAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14499)
Chromosome
9
Position
36.28 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34496
Forward primer (5'-3')
ACCCAAATTTGCCTTGTTGAT
Accessions and product sizes
Capsicum annuum NuMex-RNaky
189
Capsicum frutescens BG2814-6
189
Approximate temperature
Unknown
Reverse primer (5'-3')
AATCCATAACCTTATCCCATAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of Hpms1-117  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6002 marker 6002
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)