SGN Marker CT174

SGN-M601

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT174 image not available
Forward sequence
CTTTTTTTTTTTTTTTTAAAAAAAATTTTCAAGGCGCCTAAGTAGCCCTATCATATAAAGAAGTCTTCCAGAGAATATACAGATCATGGT
AATATTAAACTGCAAAACTTGTCTATCCTAGTTCGTGGGATTGTTTTCAGATTCCATTCGGTCTTCAAATCCGAATTGTCATCTCATGTT
ACAGCATTGAGGCCGGCCTAGCTGTTGTAATTTGTTCCACATACAAATCATCTGTCTAGGGGACTGGTAATGAGCGGTATAATAGTCGTC
TACACATCCAGATTGGGAGAACTTCAAGCTGTGTACATACTGCACAGGTCTTGATGAACTATTAAATTTTTCGACCCACATTCCCATACT
GACATCCTCCATCTTGAACAACTTTAGCTTATGGTTATCGAACTCTGAGACGACAAAGTTTGCGATGGCTGATGAAATAATGTAACCCGG
TCCATTAGCAAAAGGTGGATAATCTTCTTCTGGCCATTCCTCATATGTCACTGCCCA
Reverse sequence
TTTTTTTTTTTTCGAAGTCTTTTGTGCTTGATAGTGAAGAGGAGTTAGAAGAAAAAGAAGCCCCAAATAGACCTCTTGATGTTCCACTTA
TGGTTCCAAATCAATCAAAGACTGAAAGGAAGATTAGAGGAATCAAGAGTCCTTTGTCAAGTTTGGTTTTTGACGGTAGTTATGTGAATA
TGACTAGTAATGATGGGTTTTCTGGGATTTTGAAGTCAGCAAAAGAGGCATTTGAGGTAGGTAAAAAGTTCTGGAAAGAGCTTGAATTGT
ATAAAAAAGAAGTGGGTAGTATTGTAGAAAGTAACAAGACAGAAGAATGTCCTCATTCCATTTCAATATCAGGGTCTGAGTTTTTGGGGA
AAGGGAGAATGATGGTGTTGCCATGTGGGCTTACTCTTGGTTCACATATAACTGTTGTGGGTAAACCGAGAAGGGCTCATCAGGAGCGTG
ATCCAAAGATATCACTGCTGAGGGAAGGTCAATTCTTGATGGTTTCACAGTTTATGATGGAGTTGCAAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1597174.7e-63339 (66.9% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38993)
Chromosome
6
Position
56.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38994)
Chromosome
3
Position
101.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9586)
Chromosome
6
Position
66.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9587)
Chromosome
6
Position
52.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT174 was used as an overgo probe on plate 4 [well C7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P306L16,   P318N13,   P138D11,   P137J21,   P114N18,   P168G23,   P068F14,   P154B17,   P267N12,   P023D12,   P298O17,   P269O07,   P229D23,   P163A19,   P268K18,   P247P12,   P252J23

 Overgo Sequences

A sequence
AGTCGTCTACACATCCAGATTGGG
B sequence
CACAGCTTGAAGTTCTCCCAATCT
AB sequence
AGTCGTCTACACATCCAGATTGGGAGAACT
Marker sequence
CTTTTTTTTTTTTTTTTAAAAAAAATTTTCAAGGCGCCTAAGTAGCCCTA
TCATATAAAGAAGTCTTCCAGAGAATATACAGATCATGGTAATATTAAAC
TGCAAAACTTGTCTATCCTAGTTCGTGGGATTGTTTTCAGATTCCATTCG
GTCTTCAAATCCGAATTGTCATCTCATGTTACAGCATTGAGGCCGGCCTA
GCTGTTGTAATTTGTTCCACATACAAATCATCTGTCTAGGGGACTGGTAA
TGAGCGGTATAATAGTCGTCTACACATCCAGATTGGGAGAACTTCAAGCT
GTGTACATACTGCACAGGTCTTGATGAACTATTAAATTTTTCGACCCACA
TTCCCATACTGACATCCTCCATCTTGAACAACTTTAGCTTATGGTTATCG
AACTCTGAGACGACAAAGTTTGCGATGGCTGATGAAATAATGTAACCCGG
TCCATTAGCAAAAGGTGGATAATCTTCTTCTGGCCATTCCTCATATGTCA
CTGCCCA
Genomic location of CT174  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D601 marker 601
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)