SGN Marker CT176

SGN-M603

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CAAACCAGCCTTCCAGGACACCAGCATGGTGAACTCCGTTTGAATTTGTTCCAGAGAGCACATCACCTATTATAATCATGTATACAACAA
GAACACCTATGTTGTTTACAAGTATACATATTTGAAGCAACATCTTCCCATACTTCCCAAAGGTGTCTCCCATTAGACCTCCATAAGAAG
TAGCTTTAGAAGTCCTGCTAAATCTAATCAACAACTCAATTGAAGCTTCTGTCAGAAAAGCTGTGAAGATGATCATAGCAATCCCAGGAA
TAAGACCTAACGACTTCATTGTCGCAGGCAAGGCCATGATTCCTGCACCAACAATCGTGGTTGATAAATTAAATACAGCCCCGCTAAAGG
AAGCCCCATCAAACTCATCGAATCCAGCATCTTCCTTATGCTTAGTGGGCAACAATGGTGATTGCTCATCAACCACTGCTTGTTTATTAT
TTCGTGATTTCTTCTCTTTTACTTGTTTTAGGCTTCCAATCGTCATATTTGAATT
Reverse sequence
AAATATGACGATTGGAAGCCTAAAACAAGTAAAAGAGAAGAAATCACGAAATAATAAACAAGCAGTGGTTGATGAGCAATCACCATTGTT
GCCCACTAAGCATAAGGAAGATGCTGGATTCGATGAGTTTGATGGGGCTTCCTTTAGCGGGGCTGTATTTAATTTATCAACCACGATTGT
TGGTGCAGGAATCATGGCCTTGCCTGCGACAATGAAGTCGTTAGGTCTTATTCCTGGGATTGCTATGATCATCTTCACAGCTTTTCTGAC
AGAAGCTTCAATTGAGTTGTTGATTAGATTTAGCAGGACTTCTAAAGCTACTTCTTATGGAGGTCTAATGGGAGACACCTTTGGGAAGTA
TGGGAAGATGTTGCTTCAAATATGTATACTTGTAAACAACATAGGTGTTCTTGTTGTATACATGATTATAATAGGTGATGTGCTCTCTGG
AACAAATTCAAACGGAGTTCACCATGCTGGTGTCCTGGAAGGCTGGTTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U147351505 (100.0% of RFLP seq)+
SGN-U147351500 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53454)
Chromosome
2
Position
19.54 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51870)
Chromosome
2
Position
48.27 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9593)
Chromosome
2
Position
27.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9594)
Chromosome
2
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT176 was used as an overgo probe on plate 16 [well B7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P135K17,   P184A09,   P042L04,   P204I24,   P210H03

 Overgo Sequences

A sequence
CTTCCCATACTTCCCAAAGGTGTC
B sequence
TGGAGGTCTAATGGGAGACACCTT
AB sequence
CTTCCCATACTTCCCAAAGGTGTCTCCCAT
Marker sequence
CAAACCAGCCTTCCAGGACACCAGCATGGTGAACTCCGTTTGAATTTGTT
CCAGAGAGCACATCACCTATTATAATCATGTATACAACAAGAACACCTAT
GTTGTTTACAAGTATACATATTTGAAGCAACATCTTCCCATACTTCCCAA
AGGTGTCTCCCATTAGACCTCCATAAGAAGTAGCTTTAGAAGTCCTGCTA
AATCTAATCAACAACTCAATTGAAGCTTCTGTCAGAAAAGCTGTGAAGAT
GATCATAGCAATCCCAGGAATAAGACCTAACGACTTCATTGTCGCAGGCA
AGGCCATGATTCCTGCACCAACAATCGTGGTTGATAAATTAAATACAGCC
CCGCTAAAGGAAGCCCCATCAAACTCATCGAATCCAGCATCTTCCTTATG
CTTAGTGGGCAACAATGGTGATTGCTCATCAACCACTGCTTGTTTATTAT
TTCGTGATTTCTTCTCTTTTACTTGTTTTAGGCTTCCAATCGTCATATTT
GAATT
Genomic location of CT176  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D603 marker 603
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)