Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker GPMS171

SGN-M6035

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41596)
Chromosome
9
Position
20.30 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43564
Forward primer (5'-3')
TCCACCACAATATTTCGAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCTGTCCAACACTGTGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14534)
Chromosome
9
Position
69.16 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of GPMS171  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6035 marker 6035
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)