SGN Marker TG418

SGN-M604

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACCTCAGTTAGCAAAACAATGGCTCCAATATGCCTGACCCAACTCTAGAAAACTTCATTTGTCATCATTACAGCCTGAACAAGGAGTAGT
AGTATAGTGCGCCTAAATTCAGTTAATATGGAGTATAATTTTAGCTAAACACCACACAATTTAAGCCAATCCAAACAAACCATCAGCTGA
AGAACAGCGAGAGGGCAACCACCATTAATAACTCCCCAATGCCTCTCTCGTCGTCCAGAGTTTCATTAACACAAACTTTGATTTAGTACA
TGTAGTATCTTCCTGTTACATTTCTACTTAGTCACATTTCTATTTTAAAAGTATACCTAATAAGTTTGATAATGCATATTTTCACTCTTA
GAATTCATAGTTAGCAAATAGATATAGCAATTGTTCGGAGCTCATTAATAATCATCAGGTGTTGTAACTGAGAGCGTGTTTGTCTTTCTT
TTGTTCATAGCTTGATATGCTGAACAGTAAACAGATATCTTTTATAATGAGG
Reverse sequence
CCATGGGGGGTGCATTGTCTCCTTCGCCTCGATTATACTTATCTGAGCCTTAATGAAGTCCAATTTGCTTTGCAGTACCTTTTTCCTCAG
TCAATACTAGCTCTGTTTGCAGCAAGTAAGCATCATTACTTATGTTTCTGCTTATCTGTAGGCTGTGATGATATAGAGCTTATTGAGTTA
ATCGGGTTTTGCTCAGCTCAAACCCAAATCTTGGTAAGGATAACTAAACTGTGTTTTAAATGGTGCAACGACTATTGGGACGTGATTGAG
TGGAAGAGATATTAGGAATTCATTTAGCTTATCCAACTAGATTGTTGTTGTATGCTATTCTGGTTTGCAGCTATGGAGGTATCCCTTTCA
TTTTCCCGATTTCGTGACATATCTGAGCCTAGTTGATTACTCAACTGAGAATAATTCGTCGAGAGTAGAACACTGGAGAATATGAATTAG
GCAGCATTGTGATGGGCAGTTTTTAGCAATATATGAATGTTAATAGTTTTATGTTATCATGGAAATGGTGGCATTCGTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50385)
Chromosome
7
Position
0.24 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48319)
Chromosome
7
Position
3.72 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40036)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9595)
Chromosome
7
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG418 was used as an overgo probe on plate 8 [well G12]

Plausible BAC Matches:   P113C22,   P260B24,   P289I19,   P002D20,   P271K20,   P251C19,   P136M02,   P176A05

 Overgo Sequences

A sequence
CCTCAGTTAGCAAAACAATGGCTC
B sequence
TGGGTCAGGCATATTGGAGCCATT
AB sequence
CCTCAGTTAGCAAAACAATGGCTCCAATAT
Marker sequence
ACCTCAGTTAGCAAAACAATGGCTCCAATATGCCTGACCCAACTCTAGAA
AACTTCATTTGTCATCATTACAGCCTGAACAAGGAGTAGTAGTATAGTGC
GCCTAAATTCAGTTAATATGGAGTATAATTTTAGCTAAACACCACACAAT
TTAAGCCAATCCAAACAAACCATCAGCTGAAGAACAGCGAGAGGGCAACC
ACCATTAATAACTCCCCAATGCCTCTCTCGTCGTCCAGAGTTTCATTAAC
ACAAACTTTGATTTAGTACATGTAGTATCTTCCTGTTACATTTCTACTTA
GTCACATTTCTATTTTAAAAGTATACCTAATAAGTTTGATAATGCATATT
TTCACTCTTAGAATTCATAGTTAGCAAATAGATATAGCAATTGTTCGGAG
CTCATTAATAATCATCAGGTGTTGTAACTGAGAGCGTGTTTGTCTTTCTT
TTGTTCATAGCTTGATATGCTGAACAGTAAACAGATATCTTTTATAATGA
GG
Genomic location of TG418  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D604 marker 604
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)