SGN Marker TG345

SGN-M605

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG345 image not available
Forward sequence
CTGAGCCAATTGGTCCTGGTGTTGCAGGGGGTTCTCTGAGAGTTATTTGCCTTAAGGAACTCTACAATGGACAGTGTTTTGGACCGTTGA
TTATTGGATCGAAGAGTTTGCGGACGCTGAAGCTGTTCCGTTGTTCTGGAGATTGGGATAAGATTCTGGAAGTGATTGCTGAACAAGTCA
GTGAACTTGTTGAAATTCATCTTGAGAGGCTTCAGGTCAGTGATACCGGTCTTGCTGCTATATCTAAATGTTCCATTCTTGAAATTCTGC
ACCTTGTGAAAACGCCTGAATGCACTAATAATGGTCTAAAGACTGTTGCTGAAAACTGTAAGCTTCTAAGAAAGCTTCACATTGATGGGT
GGAAGACTAACAGGATAAGTGATGATGGGTTAATTGCTGTGGCAAAACATTGCCCCAATTTACAAGAATTGGTTTTAATAGGTGTGAATC
CAACATGTGCTAGTTTGGAGAAGTTGGCTACAAATTGCTTGAATTTAGAGAGATTAGCTCTGTGTGGAAGTGAAACTGTTG
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGCTGAGCCAATTGGTCCTGGTGTTGCAGGGGGTTCTCTGAGAGTTATTTGCCTTAAGG
AACTCTACAATGGACAGTGTTTTGGACCGTTGATTATTGGATCGAAGAGTTTGCGGACGCTGAAGCTGTTCCGTTGTTCTGGAGATTGGG
ATAAGATTCTGGAAGTGATTGCTGAACAAGTCAGTGAACTTGTTGAAATTCATCTTGAGAGGCTTCAGGTCAGTGATACCGGTCTTGCTG
CTATATCTAAATGTTCCATTCTTGAAATTCTGCACCTTGTGAAAACGCCTGAATGCACTAATAATGGTCTAAAGACTGTTGCTGAAAACT
GTAAGCTTCTAAGAAAGCTTCACATTGATGGGTGGAAGACTAACAGGATAAGTGATGATGGGTTAATTGCTGTGGCAAAACATTGCCCCA
ATTTACAAGAATTGGTTTTAATAGGTGTGAATCCAACATGTGCTAGTTTGGAGAAGTTGGCTACAAATTGCTTGAATTTAGAGAGATTAG
CTCTGTGTGGAAGTGAAACTGTTGGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1485523.7e-0544 (8.3% of RFLP seq)+
SGN-U171721455 (85.7% of RFLP seq)+
SGN-U1485524e-0544 (7.8% of RFLP seq)-
SGN-U171721457 (80.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53277)
Chromosome
4
Position
60.76 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42442)
Chromosome
4
Position
95.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40003)
Chromosome
4
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9598)
Chromosome
4
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Potato-TXB 1992   
Map version
27 (location: 9602)
Chromosome
4
Position
52.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG345 was used as an overgo probe on plate 7 [well E1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCGAAGAGTTTGCGGACGCTGAA
B sequence
AGAACAACGGAACAGCTTCAGCGT
AB sequence
ATCGAAGAGTTTGCGGACGCTGAAGCTGTT
Marker sequence
CTGAGCCAATTGGTCCTGGTGTTGCAGGGGGTTCTCTGAGAGTTATTTGC
CTTAAGGAACTCTACAATGGACAGTGTTTTGGACCGTTGATTATTGGATC
GAAGAGTTTGCGGACGCTGAAGCTGTTCCGTTGTTCTGGAGATTGGGATA
AGATTCTGGAAGTGATTGCTGAACAAGTCAGTGAACTTGTTGAAATTCAT
CTTGAGAGGCTTCAGGTCAGTGATACCGGTCTTGCTGCTATATCTAAATG
TTCCATTCTTGAAATTCTGCACCTTGTGAAAACGCCTGAATGCACTAATA
ATGGTCTAAAGACTGTTGCTGAAAACTGTAAGCTTCTAAGAAAGCTTCAC
ATTGATGGGTGGAAGACTAACAGGATAAGTGATGATGGGTTAATTGCTGT
GGCAAAACATTGCCCCAATTTACAAGAATTGGTTTTAATAGGTGTGAATC
CAACATGTGCTAGTTTGGAGAAGTTGGCTACAAATTGCTTGAATTTAGAG
AGATTAGCTCTGTGTGGAAGTGAAACTGTTG
Genomic location of TG345  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D605 marker 605
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)