SGN Marker CT177

SGN-M606

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT177 image not available
Forward sequence
AAGAAAAACCTCTTCTTTTTTTGGTTCACCAAGGTTGTTTACTTGTTTTGCTGCTAAGGGGTTTCCTGATACTGAGTCTATTATGAGTCC
TACTTCAATTCTTGATAGTAAACCTTTCACTGTTCTGAGAAACCCCTTTTGGTCTGAGCCAAAATCTCCTAAACCAGAAAGTAGAGTTCA
TTTTCAGAAACTTGACTCAAAAGGGGTTGGTCTTGGTCTTGTTGATGCTCTGATTGATGAAAAATCTGATTCTAAAGAGAT
Reverse sequence
ATCTCTTTAGAATCAGATTTTTCATCAATCAGAGCATCAACAAGACCAAGACCAACCCCTTTTGAGTCAAGTTTCTGAAAATGAACTCTA
CTTTCTGGTTTAGGAGATTTTGGCTCAGACCAAAAGGGGTTTCTCAGAACAGTGAAAGGTTTACTATCAAGAATTGAAGTAGGACTCATA
ATAGACTCAGTATCAGGAAACCCCTTAGCAGCAAAACAAGTAAACAACCTTGGTGAACCAAAAAAAGAAGAGGTTTTTCTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1447952e-134261 (100.0% of RFLP seq)+
SGN-U1447952e-134261 (100.0% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42311)
Chromosome
9
Position
78.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38996)
Chromosome
9
Position
66.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9604)
Chromosome
9
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9603)
Chromosome
9
Position
75.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT177 was used as an overgo probe on plate 15 [well A9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTCTGAGCCAAAATCTCCTAAAC
B sequence
TGAACTCTACTTTCTGGTTTAGGA
AB sequence
GGTCTGAGCCAAAATCTCCTAAACCAGAAA
Marker sequence
AAGAAAAACCTCTTCTTTTTTTGGTTCACCAAGGTTGTTTACTTGTTTTG
CTGCTAAGGGGTTTCCTGATACTGAGTCTATTATGAGTCCTACTTCAATT
CTTGATAGTAAACCTTTCACTGTTCTGAGAAACCCCTTTTGGTCTGAGCC
AAAATCTCCTAAACCAGAAAGTAGAGTTCATTTTCAGAAACTTGACTCAA
AAGGGGTTGGTCTTGGTCTTGTTGATGCTCTGATTGATGAAAAATCTGAT
TCTAAAGAGAT
Genomic location of CT177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D606 marker 606
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)