SGN Marker TG346

SGN-M607

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG346 image not available
Forward sequence
CTCACTATAGGGAGACAAGCCTGCATGCCTACAACACACTCATGTGGACGTCTCCCCATAGTTTTTTTGAAGACTATATCATGTAATATT
GTTGGTTATTATAAAGGAATTGTCTTTGGAAATACCCCAATCATAGCTATTCCAGATAACTTGAATGACAGAAAGATACTCGAAGTGCAG
CTTTATCCCTTCTGAAACTAGTCTCCTGTGACTGACCTGACAATATTTTACTGAATTTATGGATAATTGCAGTGAATGGCGCTTTTCAAG
TATAATTCTATCTAAGCAATTGTTAGAGAGTGAATTTACTGGGTCTCTGTATATACACTCAGAAGTAATAAATAGGCAACAAGATGTTTA
GCTTTTATCCGTCTCTGAAATTGATCTATCAATGGGAAAAGGGCTCAAAATCCTCAGCTTAAAGCATAAATCCAGGCCAACTCCAGCAAA
AAGGAAGATCAAAAGATTCTCCGAGACATAGACTGCGCCATCAAGAGCATGGGACCAGAAGCTGGCTGCATCCAACTCCAATGGTGGTCC
ACCTCCAAGTGTAGCAAGGCCTGCATTG
Reverse sequence
CTCCTATAGGGAGACAGCCTGCATGCCTGCAGCACACTCATGTGGACGCATCCCCATAGTTTTTTTGAAGACTATATCATGTAATATTGT
TTGTTATTATAAAGGAATTGTCTTTGGAAATACCCCAATCATAGCTATTCCAGATAACTTGAATGACAGAAAGATACTCGAAGTGCAGCT
TTATCCCTTCTGAAACTAGTCTCCTGTGACTGACCTGACAATATTTTACTGAATTTATGGATAATTGCAGTGAATGGCGCTTTTCAAGTA
TAATTCTATCTAAGCAATTGTTAGAGAGTTAATTTACTGGGTCTCTGTATATACACTCAGAAGTAATAAATAGGCAACAAGATGTTTAGC
TTTTATCCGTCTCTGAAATTGATCTATCAATGGGAAAAGGGCTCAAAATCCTCAGCTTAAAGCATAAATCCAGGCCAACTCCAGCAAAAA
GGAAGATCAAAAGATTCTCCGAGACATAGACTGCGCCATCAAGAGCATGGGACCAGAAGCTGGCTGCATCCAACTCCAATGGTGGTCCAC
CTCCAAGTGTAGCAAGGCCTGCATTGAATGCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1574302.1e-2896 (16.9% of RFLP seq)+
SGN-U151511419 (73.8% of RFLP seq)+
SGN-U1574303.9e-39102 (17.8% of RFLP seq)-
SGN-U151511419 (73.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53539)
Chromosome
8
Position
80.56 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40004)
Chromosome
8
Position
87.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9608)
Chromosome
8
Position
90.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG346 was used as an overgo probe on plate 12 [well A6]

Plausible BAC Matches:   P017E11,   P091E17,   P117O08,   P208B20,   P173I22,   P009L22,   P229F06,   P214N11,   P171P18,   P247P03,   P233D20,   P264N19,   P307D01,   P237F09,   P086B15,   P220K08

 Overgo Sequences

A sequence
GAGACAAGCCTGCATGCCTACAAC
B sequence
ACGTCCACATGAGTGTGTTGTAGG
AB sequence
GAGACAAGCCTGCATGCCTACAACACACTC
Marker sequence
CTCACTATAGGGAGACAAGCCTGCATGCCTACAACACACTCATGTGGACG
TCTCCCCATAGTTTTTTTGAAGACTATATCATGTAATATTGTTGGTTATT
ATAAAGGAATTGTCTTTGGAAATACCCCAATCATAGCTATTCCAGATAAC
TTGAATGACAGAAAGATACTCGAAGTGCAGCTTTATCCCTTCTGAAACTA
GTCTCCTGTGACTGACCTGACAATATTTTACTGAATTTATGGATAATTGC
AGTGAATGGCGCTTTTCAAGTATAATTCTATCTAAGCAATTGTTAGAGAG
TGAATTTACTGGGTCTCTGTATATACACTCAGAAGTAATAAATAGGCAAC
AAGATGTTTAGCTTTTATCCGTCTCTGAAATTGATCTATCAATGGGAAAA
GGGCTCAAAATCCTCAGCTTAAAGCATAAATCCAGGCCAACTCCAGCAAA
AAGGAAGATCAAAAGATTCTCCGAGACATAGACTGCGCCATCAAGAGCAT
GGGACCAGAAGCTGGCTGCATCCAACTCCAATGGTGGTCCACCTCCAAGT
GTAGCAAGGCCTGCATTG
Genomic location of TG346  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D607 marker 607
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)