SGN Marker TG275

SGN-M610

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTCTAGAGTCGACCTCCAGCTTCTGTTTTGTGTAATATTTGAAGCAACGACCTAAAGGTTCAACTGATTTTTTCTTTTTGATGGTTTGCA
GGTTGGGTACATAGTCACATCATGTTTGCTCAATGAGAACCATGATTTTTTGAGATTAGCAATTAATACAGTACGCAATGACATTATAGG
TCGCAACGAAACTTTCCAGTGTCTAGCATTGACTTTGGTAAGACTTGCAAATGTTTTGTGGTTCTTTAGTTGCATATATGCAGTTATTTA
CTTTTCCTAGAAGGATTTCTTTTTATTGTTAAGTGAATTGAAGCTTTGAGGTTTTTTTAAATCATATATTACGAAATATAAATTTTCATG
AATATGCGCGCAGGTTGGAAATATTGGGGGAAGGGAATTTGCTGAATCTCTGGCACCTGATGTTCAGAAGTTACTTGTAAGTGATACTTG
CAGCATTGAGCTGATATTTCAGAGTTTGAAAGTAATGTTGACTCTCTTCTTTGTCCTTCCTTTTTTGCTGCAAG
Reverse sequence
AAGTGCTTAGAATTCCCCCTCAAATGTTCCAAGAAAGCGGAGGAAACAAGAAAATTTAACCAGCAGTCAAGTTTTGAAAATCTGAATAGT
GCCATATAGCATGTCTTAGCACGTAATGTGCAAAAAGGATTAAGAGTGCAATATTTTCTTGATGAACAAGCAGCAATTTGGTAAAAGGAA
CAGCTCTCAAAGTGGAAAGAAGAAAAGCACAAGATCAGTTTTGAGTTTTGACTTAGAGATAACCATGCATTATATATGAAGAGACTGTTC
TCCATAAAGAACTAATTTACTAAAATGTCATTTGCCATAGCCAATAGCATTCACATAAAGCTCGGAACTGTACCTCAAGAATGTGCAAGG
ATAAGGACCTGATAATAAGAAACTTACAAGAGCAAGGGCTTCAAATAGGACTGCATGTGACGCATTATTTTTGTTCACATTTTTCACCAC
ATCAGTTCCCATCAATATCCGTTGTAAAACCTAATTGATTAAAATGAAAATTGAATGAGTTATAGGACATCAATCCAGATTATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1661981e-1135 (6.6% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53247)
Chromosome
6
Position
65.99 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9617)
Chromosome
6
Position
94.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9618)
Chromosome
6
Position
68.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9619)
Chromosome
6
Position
40.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG275 was used as an overgo probe on plate 3 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTCGCAACGAAACTTTCCAGTGT
B sequence
CCAAAGTCAATGCTAGACACTGGA
AB sequence
GGTCGCAACGAAACTTTCCAGTGTCTAGCA
Marker sequence
CTCTAGAGTCGACCTCCAGCTTCTGTTTTGTGTAATATTTGAAGCAACGA
CCTAAAGGTTCAACTGATTTTTTCTTTTTGATGGTTTGCAGGTTGGGTAC
ATAGTCACATCATGTTTGCTCAATGAGAACCATGATTTTTTGAGATTAGC
AATTAATACAGTACGCAATGACATTATAGGTCGCAACGAAACTTTCCAGT
GTCTAGCATTGACTTTGGTAAGACTTGCAAATGTTTTGTGGTTCTTTAGT
TGCATATATGCAGTTATTTACTTTTCCTAGAAGGATTTCTTTTTATTGTT
AAGTGAATTGAAGCTTTGAGGTTTTTTTAAATCATATATTACGAAATATA
AATTTTCATGAATATGCGCGCAGGTTGGAAATATT
Genomic location of TG275  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D610 marker 610
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)