SGN Marker TG276

SGN-M611

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG276 image not available
Forward sequence
GGGAGACATCTTGCATGCCTGCAGCCTCTCCTCCACCACCCAAATCATCATTTTCTCAGGCCTCTGATTCATTACAAAGAACAAATTGAA
GTTACCTTTGGTTTCTTTGACCAAATCTTTGCCAAATACACAATTTGATCTTATTCAGAGCGAGAAAATGGTGAATTTCATGATGGATAA
GTATATTGTTCCCAGTTTTGTTGTTTCTCTATTGGGGTTCCTTCTTCTTTATGTTTTGCGACCAAGAACCCCCAATTATAAGAAAATGGA
TCTTAAATCTACCCGAAAATGTGAAACCCACAACGTAATTTCTAGAAAATTGGAGAAAGGGACCGATGCCGATGTTATAATTGTTGGAGC
TGGGGTTGCTGGTGCTGCTCTTGCTCATACCCTTGCTAAGGTCTATTCCCAATTGCTTTCTAATTTACGGTTTTCATATTTCTAAAAGTC
CCTTTGAAAGAAATGAAAATTTTCTTATCGGCAAGGTCATAATATTGGAATGGAAGGAAGCATGATGAAAAAATTGTATTTGGATA
Reverse sequence
CAGTGGCAAAAAACAAATGTTTAGATGCTAAAGGGGGATCAGGACAATTGGTAAAAGTCACTAGACAAACATTTTCTTGTTTCCTGCTCG
TGGACACAAGTGTTAGGAATCAAAAACCAAATTTTCCATGACAAGGCAAGCCATTACAGATCACAACTTACCATCAAGATAAGAATATTA
ACAGCACCTGTATGTTGCATTAAACAAAATAGTCTACTCCCTCTTCTCGAAATGCTTAGCCTATGTCCCTTCCCAAGTTTCAAACTATGT
GAAATTGAGACCACATCATTAGATCGTCTTCTTTTATCATTTTGATACGAGAAGAATTGCAACTTATAGTACTTTCCCTATGGTTTCCGG
TCATTTCAATTTTCATTAAAGGAAAAATGAATTTATCTACAATTTATTTCTAAAAGTTGGTCCAATTAACTCTTGATAAGATAAAGTGCC
CAGTAAAGGAACTAGTATCATACATGCAAATAATTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U157681384 (71.6% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53248)
Chromosome
2
Position
54.70 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42430)
Chromosome
2
Position
3.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39972)
Chromosome
2
Position
14.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9620)
Chromosome
2
Position
7.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9622)
Chromosome
2
Position
4.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9621)
Chromosome
2
Position
15.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9624)
Chromosome
2
Position
3.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG276 was used as an overgo probe on plate 15 [well G9]

Plausible BAC Matches:   P128F04,   P264A02,   P284G15

 Overgo Sequences

A sequence
ATCTTGCATGCCTGCAGCCTCTCC
B sequence
TGATTTGGGTGGTGGAGGAGAGGC
AB sequence
ATCTTGCATGCCTGCAGCCTCTCCTCCACC
Marker sequence
GGGAGACATCTTGCATGCCTGCAGCCTCTCCTCCACCACCCAAATCATCA
TTTTCTCAGGCCTCTGATTCATTACAAAGAACAAATTGAAGTTACCTTTG
GTTTCTTTGACCAAATCTTTGCCAAATACACAATTTGATCTTATTCAGAG
CGAGAAAATGGTGAATTTCATGATGGATAAGTATATTGTTCCCAGTTTTG
TTGTTTCTCTATTGGGGTTCCTTCTTCTTTATGTTTTGCGACCAAGAACC
CCCAATTATAAGAAAATGGATCTTAAATCTACCCGAAAATGTGAAACCCA
CAACGTAATTTCTAGAAAATTGGAGAAAGGGACCGATGCCGATGTTATAA
TTGTTGGAGCTGGGGTTGCTGGTGCTGCTCTTGCTCATACCCTTGCTAAG
GTCTATTCCCAATTGCTTTCTAATTTACGGTTTTCATATTTCTAAAAGTC
CCTTTGAAAGAAATGAAAATTTTCTTATCGGCAAGGTCATAATATTGGAA
TGGAAGGAAGCATGATGAAAAAATTGTATTTGGATA
Genomic location of TG276  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D611 marker 611
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)