SGN Marker TG278

SGN-M612

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG278 image not available
Forward sequence
GACCTTCTTGCTAGTTGACGATCCATTCAGGCTGTATATGCTAAGCTCAATATCCTGAAGCAAAAGACATTATCCACTTCAGCCGGAGTG
AAAAGGAAAAAATATAAGAGAACCACAAAATAATGTGCATCTCATTTCTACAACAGTCCGTCTAACCACCTTATAAATTATCTTGCAAAT
CAAAGTTAACAGTATATTTAACCCTGCCATCTTAAAATTTGAGGAAGATAATTCTATCAAACCATGGTTTAGAGGAGGAAATGACAAAAT
GAATGTACAAAGTTTGGAGTAAGGATGTGATGGAATCGAACAATTAATAGTAAAATGGTAATCCGAACTGGAAAACTAGGCAATAAAAGT
CTGTCACTTCACAAATCAATTGTTCATCAGTTCCCATAAAGTTCCATTGGGTAGAACTACTTAGTTGTCTGTTCACAGTTGACAACAATG
TACAAGTGAATTAGATACAGAATTCTACGATCGTGCATACTCTCGTGAAAGT
Reverse sequence
AAACTTGCTGCTCCACTTCAAAATTGGCCGGTAAAGGGAAGTCTTCAGTATTATACTCAGCTGGCCAACCACGACAGGTTGCTACATGGC
AGGAGGCTTTTTAAATTCGATGGACCACTTACTTTCTCTGATGGCAATTCCACTTTCCGGATCAGCTCTCTTGGATTGTAAGACCAAACC
AAACCCATCTTTTAAATTCCACTTATTGGGAGTATTTTTGTGTTTAATCTTGAAGTTCTTGGTGTTGTCCCTTGGATTCTTGACATTATA
GTTTGAATTTGTTTTGGGGGATGAATTTTGTAGCTTGCATTACACCACGGTGACTTTGGGGACACCTGGGTTGAAGTTTCTTGTGGCTCT
TGATACTGGGAGTGACTTATTTTGGGTGCCTTGTGAATGCGGCAGATGTGCTTCTACTGATGATCCTACACTTTACAGCTCTGTATGTTT
TACTCACTTTCCCCCTTTTTTAGGGTTATCTTATATC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39973)
Chromosome
2
Position
81.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9625)
Chromosome
2
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG278 was used as an overgo probe on plate 16 [well E8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTTGCTAGTTGACGATCCATTCAG
B sequence
GCTTAGCATATACAGCCTGAATGG
AB sequence
CTTGCTAGTTGACGATCCATTCAGGCTGTA
Marker sequence
GACCTTCTTGCTAGTTGACGATCCATTCAGGCTGTATATGCTAAGCTCAA
TATCCTGAAGCAAAAGACATTATCCACTTCAGCCGGAGTGAAAAGGAAAA
AATATAAGAGAACCACAAAATAATGTGCATCTCATTTCTACAACAGTCCG
TCTAACCACCTTATAAATTATCTTGCAAATCAAAGTTAACAGTATATTTA
ACCCTGCCATCTTAAAATTTGAGGAAGATAATTCTATCAAACCATGGTTT
AGAGGAGGAAATGACAAAATGAATGTACAAAGTTTGGAGTAAGGATGTGA
TGGAATCGAACAATTAATAGTAAAATGGTAATCCGAACTGGAAAACTAGG
CAATAAAAGTCTGTCACTTCACAAATCAATTGTTCATCAGTTCCCATAAA
GTTCCATTGGGTAGAACTACTTAGTTGTCTGTTCACAGTTGACAACAATG
TACAAGTGAATTAGATACAGAATTCTACGATCGTGCATACTCTCGTGAAA
GT
Genomic location of TG278  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D612 marker 612
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)