SGN Marker GP20087

SGN-M6130

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41591)
Chromosome
11
Position
50.60 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43559
Forward primer (5'-3')
CCCTCTCCTCAATTCACA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTTACCCCTAAATTTGAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14638)
Chromosome
3
Position
60.78 cM
Confidence
uncalculated
Protocol
SSR
Subscript
A


Pepper-FAO3

PCR data   Exp. ID 34405
Forward primer (5'-3')
Unknown
Accessions and product sizes
Capsicum annuum NuMex-RNaky
259
Capsicum frutescens BG2814-6
269
Approximate temperature
Unknown
Reverse primer (5'-3')
Unknown
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14639)
Chromosome
11
Position
44.85 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3
Other PCR data 
PCR data   Exp. ID 34543
Forward primer (5'-3')
Unknown
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Capsicum frutescens BG2814-6: 206
Capsicum annuum NuMex-RNaky: 206
Approximate temperature
Unknown
  
Marker Submitted By 
Organization: DNA Landmarks
Genomic location of GP20087  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6130 marker 6130
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)