SGN Marker CT251

SGN-M614

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT251 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGGGAGTTACAAAAATTGTTAGCTCGTCTGCCAAAAGGGCAAGTGATGAAATGAA
GTTGCAAAACTTGATTTTTATCAACATACCTTTGAACAATTCATTCAAAAAAATTACAAAGACTGCTTCTCCTTTCAGCAAAAATTAGAG
GGATGAATCCCCTTTTGCTGCCATGGGGTTGCTTCTCTTCATCCAGTTATCCGGCCTACGGATATTTTAAGTAGAACCAAAAGGGGATGT
GCTAACCTTTACAAACAAAAACTAAACGGGCACCAAGAAAGTAAAACTACAAACATAATCGGGTTCGTTGCTCTTCTCTTTCTTCTCCAG
TTAATGTGGAGGAACTCACGCCTCTTTCAGCTAAACATCTCTTATATGGAACAAAACCCTTCACACGCTTCGTGGAATTTGCTCTTCCCT
CAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U153555416 (91.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9628)
Chromosome
2
Position
1.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT251 was used as an overgo probe on plate 16 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTCCAGTTAATGTGGAGGAACTC
B sequence
TAGCTGAAAGAGGCGTGAGTTCCT
AB sequence
TCTCCAGTTAATGTGGAGGAACTCACGCCT
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGGGAGTTACAAAAA
TTGTTAGCTCGTCTGCCAAAAGGGCAAGTGATGAAATGAAGTTGCAAAAC
TTGATTTTTATCAACATACCTTTGAACAATTCATTCAAAAAAATTACAAA
GACTGCTTCTCCTTTCAGCAAAAATTAGAGGGATGAATCCCCTTTTGCTG
CCATGGGGTTGCTTCTCTTCATCCAGTTATCCGGCCTACGGATATTTTAA
GTAGAACCAAAAGGGGATGTGCTAACCTTTACAAACAAAAACTAAACGGG
CACCAAGAAAGTAAAACTACAAACATAATCGGGTTCGTTGCTCTTCTCTT
TCTTCTCCAGTTAATGTGGAGGAACTCACGCCTCTTTCAGCTAAACATCT
CTTATATGGAACAAAACCCTTCACACGCTTCGTGGAATTTGCTCTTCCCT
CAA
Genomic location of CT251  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D614 marker 614
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)