SGN Marker Hpms2-2n

SGN-M6142

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14653)
Chromosome
11
Position
58.83 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34586
Forward primer (5'-3')
GCAAGGATGCTTAGTTGGGTGTC
Accessions and product sizes
Capsicum frutescens BG2814-6
146
Capsicum annuum NuMex-RNaky
146
Approximate temperature
Unknown
Reverse primer (5'-3')
TCCCAAAATTACCTTGCAGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms2-2n  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6142 marker 6142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)