SGN Marker CT252

SGN-M616

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTGGTAATTTCAACTAAGAGTTAATATACTTCTTTCTTTTTTTTCTCTCTCTATAACTTCACAATTTTTTTGACTCT
CTCTCTAAAAAGCTCAGAGATGAATTCTCAGATTTGCAGATCTGCTACAAGAGCAGCTAAGTCACTCCTTTCTGCTTCATCTAAGCAGAC
TTCTCGTGCTTTTTCAGGAGGACGAGCAGCAGCTGCAGCAGCCACAGTTTCATTGAGAGGAGTGGTGCCTTCTCTAGCCTCATATGGCAG
GAATGAATCTGGAAATGCATCTAGAGCTTGGATTTCTGGTGTGCTTGCCCTTCCTGCAGCAGCTTACATGCTCCAGGAGCAAGAAGCACA
TGCTGCCGAGATGGAGCGCACCTTTATTGCCATCAAGCCAGATGGAGTACAGAGAGGCCTGATTTCAGAAATCGTATCACGGGTTGAGCG
CAAGGGCTTCAAGCTGGTTGCAATCAAAGTTGTGATTCCTTCCAAGGAATTTG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1561573.4e-76323 (64.2% of RFLP seq)+
SGN-U144664419 (83.3% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51890)
Chromosome
8
Position
101.55 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49338)
Chromosome
8
Position
62.41 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47275)
Chromosome
8
Position
105.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42340)
Chromosome
8
Position
117.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39034)
Chromosome
8
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9635)
Chromosome
8
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9634)
Chromosome
8
Position
89.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT252 was used as an overgo probe on plate 12 [well C2]

Plausible BAC Matches:   P168M24,   P304F23,   P276E06,   P046A15,   P149C09,   P319O07,   P202N15,   P299C06,   P107E16,   P301B12,   P034F07

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGCAGCCACAGTTTCATTGAGAGG
B sequence
TAGAGAAGGCACCACTCCTCTCAA
AB sequence
AGCAGCCACAGTTTCATTGAGAGGAGTGGT
Marker sequence
CTTTTTTTTTTTTTTGGTAATTTCAACTAAGAGTTAATATACTTCTTTCT
TTTTTTTCTCTCTCTATAACTTCACAATTTTTTTGACTCTCTCTCTAAAA
AGCTCAGAGATGAATTCTCAGATTTGCAGATCTGCTACAAGAGCAGCTAA
GTCACTCCTTTCTGCTTCATCTAAGCAGACTTCTCGTGCTTTTTCAGGAG
GACGAGCAGCAGCTGCAGCAGCCACAGTTTCATTGAGAGGAGTGGTGCCT
TCTCTAGCCTCATATGGCAGGAATGAATCTGGAAATGCATCTAGAGCTTG
GATTTCTGGTGTGCTTGCCCTTCCTGCAGCAGCTTACATGCTCCAGGAGC
AAGAAGCACATGCTGCCGAGATGGAGCGCACCTTTATTGCCATCAAGCCA
GATGGAGTACAGAGAGGCCTGATTTCAGAAATCGTATCACGGGTTGAGCG
CAAGGGCTTCAAGCTGGTTGCAATCAAAGTTGTGATTCCTTCCAAGGAAT
TTG
Genomic location of CT252  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D616 marker 616
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)