SGN Marker GP1127

SGN-M6161

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41584)
Chromosome
12
Position
30.40 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43552
Forward primer (5'-3')
CACCACCAGTCACAAAGTTAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCCTTCAAATACATCCCATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14673)
Chromosome
12
Position
26.57 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34385
Forward primer (5'-3')
Unknown
Accessions and product sizes
Capsicum annuum NuMex-RNaky
180
Capsicum frutescens BG2814-6
184
Approximate temperature
Unknown
Reverse primer (5'-3')
Unknown
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Organization: DNA Landmarks
Genomic location of GP1127  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6161 marker 6161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)