SGN Marker TG422

SGN-M618

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGGAGAAAGGGAAAATGAAGAACACTGTTGCCGAGATGTTGAATTTGCGTAAGATCAGGTAGTGAAGGACAGAAGTCTACTCTTATAATG
TTATCTGTTGTTTTTGTTTCTTCACATTTACCTACTATATGGGGGTTGGGGTCTGGCTTTCACAAACAACAGATTGCTTGCCTTTAGAAT
TTGAGTTGGTGTAGCATTGGTTGCTTGGACGATGTATAAGTTGCTAGCTATTCTTTGCTACTCAAAGATAATGAAAAATGATGAGGCTGA
TGTTTGACTGTGCAATTGATTTGCTATCAGCCTATCCAAAGTTGCACTAAATGTTTGGCATTCACAGATTGTCCCGGGCAACCTAAACCA
CATGGTTGACCACTGCAATGTACCTATTGATAACCGTATCCATGCCATTGACATGGATCTC
Reverse sequence
GCATGCCTGCAGCAGTTGACCAAGTATCATAGTGGTTTCCCAATGTGTGACAAATGATAATTGCGTGGACCCAAATGGGTTGCCTGTGTT
TGACAAGAACTTTGCTAACCCACATATTCCACTTTTCAAACATAGGCAACCTTGCACAAGTTTTAAGTTGTGTGAGGCATTTTGATTCAC
ACAAACTCGATTTGTCATAACATAAAGAGACACACATAACTTGTGTCAGTTGTGTGAGGTACAAAAGTATTTTTTTTCTCGATCTGCATC
AACTGGATATTCCAAAGTAGCCCATAGTCCCCCTTCCTATTGCACAACATTCATTTTGCTCACTTTTCCATACTTCGGTGAACAATTCAC
CATTTACTTGAACAGTCTTTCCCCATAGTCGACCATAAAGACAACAACAACATTGAGCATACTTATACTTGCCTTTGACCCTCCCTATAT
CACATATTTCTAAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1518051.5e-2558 (13.8% of RFLP seq)+
SGN-U1518059.7e-27112 (26.6% of RFLP seq)+
SGN-U1655671.9e-71155 (33.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53553)
Chromosome
10
Position
79.20 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53310)
Chromosome
10
Position
67.63 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40039)
Chromosome
10
Position
83.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9643)
Chromosome
6
Position
89.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG422 was used as an overgo probe on plate 2 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGATTGTCCCGGGCAACCTAAACC
B sequence
CAGTGGTCAACCATGTGGTTTAGG
AB sequence
AGATTGTCCCGGGCAACCTAAACCACATGG
Marker sequence
AGGAGAAAGGGAAAATGAAGAACACTGTTGCCGAGATGTTGAATTTGCGT
AAGATCAGGTAGTGAAGGACAGAAGTCTACTCTTATAATGTTATCTGTTG
TTTTTGTTTCTTCACATTTACCTACTATATGGGGGTTGGGGTCTGGCTTT
CACAAACAACAGATTGCTTGCCTTTAGAATTTGAGTTGGTGTAGCATTGG
TTGCTTGGACGATGTATAAGTTGCTAGCTATTCTTTGCTACTCAAAGATA
ATGAAAAATGATGAGGCTGATGTTTGACTGTGCAATTGATTTGCTATCAG
CCTATCCAAAGTTGCACTAAATGTTTGGCATTCACAGATTGTCCCGGGCA
ACCTAAACCACATGGTTGACCACTGCAATGTACCTATTGATAACCGTATC
CATGCCATTGACATGGATCTC
Genomic location of TG422  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D618 marker 618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)