SGN Marker GP1017

SGN-M6185

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41580)
Chromosome
12
Position
66.20 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43548
Forward primer (5'-3')
TTTTGATCCCTCGATAAGTCTTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCACACCAGACTCAGCCAATTTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14697)
Chromosome
12
Position
49.98 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34442
Forward primer (5'-3')
Unknown
Accessions and product sizes
Capsicum frutescens BG2814-6
207
Capsicum annuum NuMex-RNaky
204
Approximate temperature
Unknown
Reverse primer (5'-3')
Unknown
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Organization: DNA Landmarks
Genomic location of GP1017  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6185 marker 6185
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)