SGN Marker TG350

SGN-M619

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG350 image not available
Forward sequence
ATAGGGAGACAGCTTGCATGCCTGCAGGAAAGCCATTCAATTTTGTCTCAGTGGCTTTTGCTGCTTCGATCTATATTCTTTACCTGGAAT
TGCGCTGGTCTATGGGAATACAAATTTTTGCTCATTCCTTGACCACATACCTGCTATTTTGAAGCCAACTGTAAACCAAAGGACTGCATC
ATTTAGAAGCCAGAAAGAGTGAACTTGGAGGCGCCTTTCCTAGATCCAGGAGATGAAGATTTTGTTCTATTGGAATTTCTAGGGCACACA
GATTTCTTCCCCTTACAGATAAAATCCCAGTCTTTTTTTTTTGGCTGTTTTGAAGTATATAATGGATAGTGAAAGAGCATATTTCTTTAG
GTTATATGTGACAGTTTGTCACAGTCTGTATGTATTATGCTTTTTGCGAAGTGAACATTATCAAATTTTGCTTATTCAATAACTCAACAA
CATTATTCTTTACTCCACTTGACTACTTCTCTTCTCCATTGATTAGCTTTCTTGCTTTCTTCATGCTTTTTACCACATTTTTATCTTGCA
TTACCATAAGGTACCTGTGA
Reverse sequence
CTCACTATAGGGAGACAGCCTGCATGCCTGCAGGAAAGCCATTCAATTTTGTCTCAGTGGCTTTTGCTGCTTCGATCTATATTCTTTACC
TGGAATTGCGCTGGTCTATGGGAATACAAATTTTTGCTCATTCCTTGACCACATACCTGCTATTTTGAAGCCAACTGTAAACCAAAGGAC
TGCATCATTTAGAAGCCAGAAAGAGTGAACTTGGAGGCGCCTTTCCTAGATCCAGGAGATGAAGATTTTGTTCTATTGGAATTTCTAGGG
CACACAGATTTCTTCCCCTTACAGATAAAATCCCAGTCTTTTTTTTTTGGCTGTTTTGAAGTATATAATGGATAGTGAAAGAGCATATTT
CTTTAGGTTATATGTGACAGTTTGTCACAGTCTGTATGTATTATGCTTTTTGCGAAGTGTACATTATCAAATTTTGCTTATTCAATAACT
CAACAACATTATTCTTTACTCCACTTGACTACTTCTCTTCTCCATTGATTAGTTTTCTTGCTTTCTTCATGCTTTTTACCACATTTTTAT
CTTGCATTACCATAAGGTACCTGTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1566941e-159333 (59.5% of RFLP seq)+
SGN-U1566941e-159333 (58.9% of RFLP seq)-
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41631)
Chromosome
12
Position
120.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40007)
Chromosome
12
Position
120.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9645)
Chromosome
12
Position
132.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Pepper-FAO3   
Map version
31 (location: 9648)
Chromosome
12
Position
101.05 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9646)
Chromosome
12
Position
91.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG350 was used as an overgo probe on plate 15 [well G11]

Plausible BAC Matches:   P033N22,   P313F17,   P053L10,   P312L18,   P244E21,   P224N06,   P244G21,   P197J21,   P237G22

 Non-Plausible BAC matches

P147G13,   P203A07,   P116D04

 Overgo Sequences

A sequence
GCCAGAAAGAGTGAACTTGGAGGC
B sequence
TGGATCTAGGAAAGGCGCCTCCAA
AB sequence
GCCAGAAAGAGTGAACTTGGAGGCGCCTTT
Marker sequence
ATAGGGAGACAGCTTGCATGCCTGCAGGAAAGCCATTCAATTTTGTCTCA
GTGGCTTTTGCTGCTTCGATCTATATTCTTTACCTGGAATTGCGCTGGTC
TATGGGAATACAAATTTTTGCTCATTCCTTGACCACATACCTGCTATTTT
GAAGCCAACTGTAAACCAAAGGACTGCATCATTTAGAAGCCAGAAAGAGT
GAACTTGGAGGCGCCTTTCCTAGATCCAGGAGATGAAGATTTTGTTCTAT
TGGAATTTCTAGGGCACACAGATTTCTTCCCCTTACAGATAAAATCCCAG
TCTTTTTTTTTTGGCTGTTTTGAAGTATATAATGGATAGTGAAAGAGCAT
ATTTCTTTAGGTTATATGTGACAGTTTGTCACAGTCTGTATGTATTATGC
TTTTTGCGAAGTGAACATTATCAAATTTTGCTTATTCAATAACTCAACAA
CATTATTCTTTACTCCACTTGACTACTTCTCTTCTCCATTGATTAGCTTT
CTTGCTTTCTTCATGCTTTTTACCACATTTTTATCTTGCATTACCATAAG
GTACCTGTGA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D619 marker 619
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)