SGN Marker asu11

SGN-M6191

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14705)
Chromosome
12
Position
56.28 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34440
Forward primer (5'-3')
GGTTTCTCGATGTGAGGGTTGGTCTTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CCAACTCTCTCTACCTGAAGGAGCCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Umesh Reddy
Organization: Alcorn State University
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of asu11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6191 marker 6191
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)