SGN Marker CT183

SGN-M622

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
550
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT183 image not available
Forward sequence
AGTGAAGCACGTGAAGATCTTGCTGCCCTCGAGAAGGATTATGAGGAGGTTGGTGCTGAAGGTGATGATGAAGCAGATGGTGAAGATGAT
GAGGAGTACTAAGCCATGATGTACGCTGCAAAATGCCGGTCTGTTTTTATTTTCTTCAACGTCTTTATGTTGCACTAGTAAAAACTTTTA
TGTGGGTTGAATTCCCTTTGGACCTCCAGGTACTGGTAAAACAATGCTTGCGAAAGCTGTTGCTACTGAGGCTGGTGCAAACTTTATCAA
CATATCAATGTCGAGCATTACATCCAAGTGGCTCGGTGAAGGGGAGAAGTATGTCGAAGCAGTCTTCACATTATCTAGTAAAATAGCTCC
GAGTGTTATTTTCGTTGACGACGTGGACAGCATGTTGGGAAGACGAGAAAATC
Reverse sequence
ATTCTTCATCTTCCGCATAGCTTCATGCTCTCCCGGATTTTCTCGTCTTCCCAACATGCTGTCCACCTCGTCAACGAAAATAACACTCGG
AGCTATTTTACTAGCTAATGTGAAGACTGCTTTGACATACTTCTCCCCTTCACCGAACCACTTGGATGTAATGCTTGACATTGATATGTT
GATAAAGTTTGCACCAGCCTCAGTAGCAACAGCTTTCGCAAGCATTGTTTTACCAGTACCTGGAGGTCCAAAGGGAATTCAACCCACATA
AAAGTTTTTACTAGTGCAACATAAAGACACTGAAGAAAATAAAAACAGACCGGCATTTTACAGCCTACATCATGGCTTAGTACTCCTCAT
CATCTTCACCATCTGCTTCATCATCACCTTCAGCACCAACCTCCTCATAATCCTTCTCGAGGGCAGCAAGATCTTCACGTGCTTCACT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1716524.9e-10100 (24.2% of RFLP seq)+
SGN-U1713532e-1260 (14.5% of RFLP seq)+
SGN-U1432042e-1260 (14.5% of RFLP seq)+
SGN-U1603672e-1260 (14.5% of RFLP seq)+
SGN-U1471603.5e-20217 (52.5% of RFLP seq)+
SGN-U1618135.1e-50103 (24.9% of RFLP seq)+
SGN-U1618133.2e-51117 (28.3% of RFLP seq)+
SGN-U1432052.7e-73190 (46.0% of RFLP seq)+
SGN-U1603713.6e-97194 (47.0% of RFLP seq)+
SGN-U1432033.6e-97194 (47.0% of RFLP seq)+
SGN-U1463064e-109218 (52.8% of RFLP seq)+
SGN-U1713532.2e-1260 (13.4% of RFLP seq)-
SGN-U1432042.2e-1260 (13.4% of RFLP seq)-
SGN-U1603672.2e-1260 (13.4% of RFLP seq)-
SGN-U1716524.1e-26135 (30.1% of RFLP seq)-
SGN-U1471607.1e-34248 (55.4% of RFLP seq)-
SGN-U1618132.3e-52103 (23.0% of RFLP seq)-
SGN-U1432052e-80190 (42.4% of RFLP seq)-
SGN-U1618131.3e-81152 (33.9% of RFLP seq)-
SGN-U1603711e-106194 (43.3% of RFLP seq)-
SGN-U1432031e-106194 (43.3% of RFLP seq)-
SGN-U1463067e-142253 (56.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9654)
Chromosome
9
Position
63.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT183 was used as an overgo probe on plate 16 [well A4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTGAAGCACGTGAAGATCTTGCTG
B sequence
TAATCCTTCTCGAGGGCAGCAAGA
AB sequence
GTGAAGCACGTGAAGATCTTGCTGCCCTCG
Marker sequence
AGTGAAGCACGTGAAGATCTTGCTGCCCTCGAGAAGGATTATGAGGAGGT
TGGTGCTGAAGGTGATGATGAAGCAGATGGTGAAGATGATGAGGAGTACT
AAGCCATGATGTACGCTGCAAAATGCCGGTCTGTTTTTATTTTCTTCAAC
GTCTTTATGTTGCACTAGTAAAAACTTTTATGTGGGTTGAATTCCCTTTG
GACCTCCAGGTACTGGTAAAACAATGCTTGCGAAAGCTGTTGCTACTGAG
GCTGGTGCAAACTTTATCAACATATCAATGTCGAGCATTACATCCAAGTG
GCTCGGTGAAGGGGAGAAGTATGTCGAAGCAGTCTTCACATTATCTAGTA
AAATAGCTCCGAGTGTTATTTTCGTTGACGACGTGGACAGCATGTTGGGA
AGACGAGAAAATC
Genomic location of CT183  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D622 marker 622
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)