SGN Marker CT184

SGN-M624

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT184 image not available
Forward sequence
CATCTGAATTGGTGGCCTAGTCCAGGACTTCTTCTCTGCTATTGTCGAAATCAACTCCACTTCAGCACTCATTGTTGACTCAGGTTGCCC
AGGAAATTTTTTTATCTTCCACACCAAAGAGTCAATGGATGGATTGTACTTTGCTCTCCCTGATGTCACCTGGAAGCTTGCTTTTGCAGT
TTGCTTTGGCACTGGAACTTTAATGACAACTCCAAGAGCAAACATTTTTGCACCAAACACACTCTTAACCTTAACATTCACTTCCATTCG
CGTACGACCTAATTCCTTGATTGTTGGCAATACACGGAAAGGAAGATTTACTCCTTCGGTAATGCGGTACTTCATCAGTTC
Reverse sequence
GAACTGATGAAGTACCGCATTACCGAAGGAGTAAATCTTCCTTTCCGTGTATTGCCAACAATCAAGGAATTAGGTCGTACGCGAATGGAA
GTGAATGTTAAGGTTAAGAGTGTGTTTGGTGCAAAAATGTTTGCTCTTGGAGTTGTCATTAAAGTTCCAGTGCCAAAGCAAACTGCAAAA
GCAAGCTTCCAGGTGACATCAGGGAGAGCAAAGTACAATCCATCCATTGACTCTTTGGTGTGGAAGATAAAAAAATTTCCTGGGCAAACT
GAGTCAACAATGAGTGCTGAAGTGGAGTTGATTTCGACAATAGCAGAGAAGAAGTCCTGGACTAGGCCACCAATTCAGATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1610913.8e-4188 (25.1% of RFLP seq)+
SGN-U1443908e-101341 (97.2% of RFLP seq)+
SGN-U144393351 (100.0% of RFLP seq)+
SGN-U144391351 (100.0% of RFLP seq)+
SGN-U1610911.6e-4388 (25.1% of RFLP seq)-
SGN-U1443903e-103341 (97.2% of RFLP seq)-
SGN-U144393351 (100.0% of RFLP seq)-
SGN-U144391351 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9655)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9656)
Chromosome
12
Position
54.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT184 was used as an overgo probe on plate 5 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCTGAATTGGTGGCCTAGTCCA
B sequence
AGCAGAGAAGAAGTCCTGGACTAG
AB sequence
CATCTGAATTGGTGGCCTAGTCCAGGACTT
Marker sequence
CATCTGAATTGGTGGCCTAGTCCAGGACTTCTTCTCTGCTATTGTCGAAA
TCAACTCCACTTCAGCACTCATTGTTGACTCAGGTTGCCCAGGAAATTTT
TTTATCTTCCACACCAAAGAGTCAATGGATGGATTGTACTTTGCTCTCCC
TGATGTCACCTGGAAGCTTGCTTTTGCAGTTTGCTTTGGCACTGGAACTT
TAATGACAACTCCAAGAGCAAACATTTTTGCACCAAACACACTCTTAACC
TTAACATTCACTTCCATTCGCGTACGACCTAATTCCTTGATTGTTGGCAA
TACACGGAAAGGAAGATTTACTCCTTCGGTAATGCGGTACTTCATCAGTT
C
Genomic location of CT184  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D624 marker 624
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)