SGN Marker TG426

SGN-M627

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG426 image not available
Forward sequence
GCCTGCAGTAAAAGATGGTTCTGAGGCAGCATGGTGTTTCCAGGAGGATTCGTTGTTACCATTGTGATCAACGATCCAGAGTGTAGTGCA
CCTATGGCGTTATCCTTCATTTACCACAAGGCTACGACCATAGGTGTTAGTGTAATTAATCAAATCAAAGTGTGGTCAGGTTGTGCCTGC
Reverse sequence
TTCAGTAAAGATTCCGACAGCTGCAATAGGTAAAGCATCCCTGTGCATTCCCTCAATCTGCATTTGTACTTGATCTATTAACAATATCTA
TATGCAGTTGCCGCAGTTTGTATCGCAGTGCTGGCCATAATATCAGTTCCAATCGTCTATTGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1718713.7e-95178 (98.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53313)
Chromosome
2
Position
85.27 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40041)
Chromosome
2
Position
89.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9664)
Chromosome
2
Position
77.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9668)
Chromosome
2
Position
33.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9667)
Chromosome
2
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG426 was used as an overgo probe on plate 6 [well A8]

Plausible BAC Matches:   P036H21,   P237C16,   P134G09,   P174M23,   P026F21,   P125J21,   P169M11

 Overgo Sequences

A sequence
GATCAACGATCCAGAGTGTAGTGC
B sequence
GGATAACGCCATAGGTGCACTACA
AB sequence
GATCAACGATCCAGAGTGTAGTGCACCTAT
Marker sequence
GCCTGCAGTAAAAGATGGTTCTGAGGCAGCATGGTGTTTCCAGGAGGATT
CGTTGTTACCATTGTGATCAACGATCCAGAGTGTAGTGCACCTATGGCGT
TATCCTTCATTTACCACAAGGCTACGACCATAGGTGTTAGTGTAATTAAT
CAAATCAAAGTGTGGTCAGGTTGTGCCTGC
Genomic location of TG426  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D627 marker 627
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)