SGN Marker TG2

SGN-M628

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG2 image not available
Forward sequence
not available
Reverse sequence
GAGGAAAGGAAGCCAACTCTTTATTTTATCGCAATGTTTGGGGGAAACTGCCTCAATCCCAGGAATTTGTAAAGGATGGACGGTAAGTAC
AAATCCACGGGTGCAAAATGATACAAGTCGTGATGAAACTGAAACTGCTAAATAGAAGGTTGAAGGGACTACACTATCATTAATTGGGGG
CTTATGAAAGGTATTAGATCAGAACAGAGAAATGTTGAAGAAGGCTCAGCAAAAGTTACAAGAGCAGCCTCTAAATAATATTTTTCAGAC
AGTGAAAAGAGAAACGTATGCAAAATTTAAACAAAGCTCCTATTTAGCAGAATTAAACTTGCAGCAGCAAAGCAAAGTGAAATGGTTGAA
GCTAGGGAATGATAATAATAGATATTTTTTCTCTATGATCAAGCATAGAAGGTTTATGTCAGCTACCACTAAACTGAGGGATATACAGGG
GCAATGGAAGACTGATCCTGAAAGCATAGCTCAGATCATTGTAAACTACTATAAAAAAACACTTAGGAGAGAAAGCAAAAATAAAGTGAA
AGCAATAAGGGGGTTTTACACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39939)
Chromosome
4
Position
56.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9669)
Chromosome
4
Position
42.30 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG2 was used as an overgo probe on plate 8 [well D1]

Plausible BAC Matches:   P334C02,   P164J03,   P313N13,   P054O03,   P059C19,   P330A04,   P285A23,   P143E06,   P080K14,   P230E11,   P251O22,   P059L06,   P307G18,   P123L18,   P300K04,   P080I05,   P080K11,   P327A09,   P011C24,   P103K24,   P053B23,   P113A20

 Overgo Sequences

A sequence
ATGTTGAAGAAGGCTCAGCAAAAG
B sequence
GAGGCTGCTCTTGTAACTTTTGCT
AB sequence
ATGTTGAAGAAGGCTCAGCAAAAGTTACAA
Marker sequence
GAGGAAAGGAAGCCAACTCTTTATTTTATCGCAATGTTTGGGGGAAACTG
CCTCAATCCCAGGAATTTGTAAAGGATGGACGGTAAGTACAAATCCACGG
GTGCAAAATGATACAAGTCGTGATGAAACTGAAACTGCTAAATAGAAGGT
TGAAGGGACTACACTATCATTAATTGGGGGCTTATGAAAGGTATTAGATC
AGAACAGAGAAATGTTGAAGAAGGCTCAGCAAAAGTTACAAGAGCAGCCT
CTAAATAATATTTTTCAGACAGTGAAAAGAGAAACGTATGCAAAATTTAA
ACAAAGCTCCTATTTAGCAGAATTAAACTTGCAGCAGCAAAGCAAAGTGA
AATGGTTGAAGCTAGGGAATGATAATAATAGATATTTTTTCTCTATGATC
AAGCATAGAAGGTTTATGTCAGCTACCACTAAACTGAGGGATATACAGGG
GCAATGGAAGACTGATCCTGAAAGCATAGCTCAGATCATTGTAAACTACT
ATAAAAAAACACTTAGGAGAGAAAGCAAAAATAAAGTGAAAGCAATAAGG
GGGTTTTACACA
Genomic location of TG2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D628 marker 628
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)