SGN Marker TG442

SGN-M629

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG442 image not available
Forward sequence
not available
Reverse sequence
CGGTACCGGGGATCTCTAGAGTCACCTGCTGTTTTATTTTTATTGATCACAGAAAAAGAACCAGAATTAGTTAGATCGATTAATTATTTC
AATTGAGAAATAAATAGCATAAAGTTTTTATCCAGCTAACTAACAACCCCAAATAGCCAACAAGATCAATTTATTTAAATGGTCCTGCTC
CTAAATGAACTCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42463)
Chromosome
3
Position
107.90 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9674)
Chromosome
3
Position
123.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9673)
Chromosome
3
Position
80.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG442 was used as an overgo probe on plate 4 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTCTAGAGTCACCTGCTGTTTTA
B sequence
CTGTGATCAATAAAAATAAAACAG
AB sequence
TCTCTAGAGTCACCTGCTGTTTTATTTTTA
Marker sequence
ATCTCTAGAGTCACCTGCTGTTTTATTTTTATTGATCACAGAAAAAGAAC
CAGAATTAGTTAGATCGATTAATTATTTCAATTGAGAAATAAATAGCATA
AAGTTTTTATCCAGCTAACTAACAACC
Genomic location of TG442  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D629 marker 629
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)