SGN Marker TG224

SGN-M63

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG224 image not available
Forward sequence
TAAACAGTATACTCAACAGAGCTTCAGACATCTACTTTACAGTATAATATACACCATGGAATAATACTGATGGATAAGAAATAGTCCCAA
CATTACTAATACACTGATCGCTACATCCAACTGTTATCTTTCTTATAAAGTCAATGATTTTACCTTTGGAGATCAGACATGGCCTTCTCA
ACCTCCCACCTAGAAGGAACAGAACCAAAAACAGTCTCATAATAAGGAGACCCTTTTTCAACAAACTCATCAAAAGATCCACTATCAAGA
ATCTTAGAGTTTGAACCATATTCAATACACCTATTCTTATTCCAAGATTCTCCAAAGGGTGTTTCACAAATTGATGACAAAGAAGGGGGA
GGGTGGATATTGGAGTCCCTGTGGGTGGGTAGGGGGTAGGGGTAGTGAAACAATTGGTTGGAGTTTGTACTTGTAAAGAGTGGCAACAT
Reverse sequence
CAGAAACACCAACCAGCAAGAGAGAGAAAAATTCATTGACCAATCTCATTGCTCTAAATGACAGTGGGAACAACCCTAATGTATTTGCCC
TCGTGCTTTCGTCAAGTGGTATGAGCACAGCACTTGGTATGGATATGGCTCATAGCACAGGTTCGAACCTTGCCACATACAAAATCATGT
AATTTAAGTGGAGAAGGGTAGAAGGGTTGGGCCATTATCCACGAGTTCCGAACAGTGTGCCACAAGCCTTTAACAATTCAATTTCAATAA
ATCAAACCATTTCCCCTTAAACAATTCAATTTCAATAAATCAAACCATTTCCTAGTTCTAATCAATTTGTTACTAGCACATAAATAATTT
AAAACCTAGCAGCGAAAATGATTAAGATTAGCAATCGACAGTGTTCAATGCCAAATTAGCTACTTCCACTCCATTCAAACAAAAAAACAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1511783e-153296 (65.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53223)
Chromosome
3
Position
102.82 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42420)
Chromosome
1
Position
88.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39948)
Chromosome
1
Position
53.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7923)
Chromosome
1
Position
104.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7922)
Chromosome
1
Position
39.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35620
Forward primer (5'-3')
TCAACCTCCCACCTAGAAGGAAC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 300+500
Solanum lycopersicum LA925: 400+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GAACCTTGCCACATACAAAATCATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG224 was used as an overgo probe on plate 14 [well F8]

Plausible BAC Matches:   P257K22,   P037H06,   P210H16,   P096O18,   P202L21,   P164P14,   P060I12,   P031F22,   P075I11,   P283F11,   P222J15,   P203B23,   P306O08,   P252G08,   P101F20,   P274O24,   P101E20,   P192E09,   P277O15,   P203M07,   P294D23,   P261N22,   P239A04,   P269L04,   P211B18,   P145M16,   P296N15,   P264E13,   P294C21,   P251P23,   P179C13,   P018B04

 Overgo Sequences

A sequence
AGATCAGACATGGCCTTCTCAACC
B sequence
TTCCTTCTAGGTGGGAGGTTGAGA
AB sequence
AGATCAGACATGGCCTTCTCAACCTCCCAC
Marker sequence
TAAACAGTATACTCAACAGAGCTTCAGACATCTACTTTACAGTATAATAT
ACACCATGGAATAATACTGATGGATAAGAAATAGTCCCAACATTACTAAT
ACACTGATCGCTACATCCAACTGTTATCTTTCTTATAAAGTCAATGATTT
TACCTTTGGAGATCAGACATGGCCTTCTCAACCTCCCACCTAGAAGGAAC
AGAACCAAAAACAGTCTCATAATAAGGAGACCCTTTTTCAACAAACTCAT
CAAAAGATCCACTATCAAGAATCTTAGAGTTTGAACCATATTCAATACAC
CTATTCTTATTCCAAGATTCTCCAAAGGGTGTTTCACAAATTGATGACAA
AGAAGGGGGAGGGTGGATATTGGAGTCCCTGTGGGTGGGTAGGGGGTAGG
GGTAGTGAAACAATTGGTTGGAGTTTGTACTTGTAAAGAGTGGCAACAT
Genomic location of TG224  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D63 marker 63
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)