SGN Marker CD13

SGN-M630

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBR
Cutting Site
PST1
Drug Resistance
TET
Image
Forward sequence
not available
Reverse sequence
GGGGGGGGTGTCCGGNAATAGGTTTGCTGGAGGAACATAGCCATGAGCATGAAGCTGTGACCCAACACTTGCCACAGACGGGATGGAGCT
TAGCTCCAAGAATTGAACCAGTTGTGCGTGCAATATCTGACTGCAAATTTCCATCTTTTCTAGATGATACATCTTGGTTACATAGAGGTT
CTGATGTGGATTTAAAAAGCCAGATATTACAACTTCAAAGTTGTCTAACAAAGTACTTCACAGAGATTAGCAAGTTGATGGTACTGCCAC
TTGCAGAAAAAGAGGCAAGTGTTATGATGCAGAAGTTTGTGCAGCTTCAACTCCAGAACTCATACTACTACATTGTTCCAAACTGGGTTA
TGATTTTCCAACGGGCATTCAATTGGCAGTTGATGAAATTAGCTAAGGAGACATCTTTCTCAGTGTATATCCTGATAAAGCATGATTTGT
CCACTTCAATGCTTGGAGCTGTGGAACTCGAAGCCTCTGCACAGCCGCATTACCATTTGTCACATCCATCTCTTGATGAAATGGTTGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9675)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9676)
Chromosome
6
Position
10.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD13 was used as an overgo probe on plate 14 [well F7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P250K09,   P089G20,   P231M02,   P188C17,   P215O21,   P112I01,   P172C07,   P118G20,   P247H14,   P013P13,   P241P14,   P013O12,   P280E04,   P166M22,   P056M09

 Overgo Sequences

A sequence
GTTTGCTGGAGGAACATAGCCATG
B sequence
GTCACAGCTTCATGCTCATGGCTA
AB sequence
GTTTGCTGGAGGAACATAGCCATGAGCATG
Marker sequence
GGGGGGGGTGTCCGGNAATAGGTTTGCTGGAGGAACATAGCCATGAGCAT
GAAGCTGTGACCCAACACTTGCCACAGACGGGATGGAGCTTAGCTCCAAG
AATTGAACCAGTTGTGCGTGCAATATCTGACTGCAAATTTCCATCTTTTC
TAGATGATACATCTTGGTTACATAGAGGTTCTGATGTGGATTTAAAAAGC
CAGATATTACAACTTCAAAGTTGTCTAACAAAGTACTTCACAGAGATTAG
CAAGTTGATGGTACTGCCACTTGCAGAAAAAGAGGCAAGTGTTATGATGC
AGAAGTTTGTGCAGCTTCAACTCCAGAACTCATACTACTACATTGTTCCA
AACTGGGTTATGATTTTCCAACGGGCATTCAATTGGCAGTTGATGAAATT
AGCTAAGGAGACATCTTTCTCAGTGTATATCCTGATAAAGCATGATTTGT
CCACTTCAATGCTTGGAGCTGTGGAACTCGAAGCCTCTGCACAGCCGCAT
TACCATTTGTCACATCCATCTCTTGATGAAATGGTTGA
Genomic location of CD13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D630 marker 630
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)