SGN Marker TG539

SGN-M631

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG539 image not available
Forward sequence
not available
Reverse sequence
ATGTTAACTATACAATACCCTTTATAATCGGCTGTCGCCTTTATGCAAGGATCCAGACAAACAAATAATAATAACAACAACAGCAAATAA
TGCTATATCCACTTCAATTTGCTTGCCCTGCTCAAATTTTTATTCCATTTAAAAAAGAACGCCGTCTTTCTCTTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9677)
Chromosome
6
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG539 was used as an overgo probe on plate 4 [well B7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P156D19,   P289K15,   P276A07,   P258M24,   P050M21,   P160N03

 Overgo Sequences

A sequence
CCTTTATAATCGGCTGTCGCCTTT
B sequence
GTCTGGATCCTTGCATAAAGGCGA
AB sequence
CCTTTATAATCGGCTGTCGCCTTTATGCAA
Marker sequence
ATGTTAACTATACAATACCCTTTATAATCGGCTGTCGCCTTTATGCAAGG
ATCCAGACAAACAAATAATAATAACAACAACAGCAAATAATGCTATATCC
ACTTCAATTTGCTTGCCCTGCTCAAATTTTTATTCCATTTAAAAAAGAAC
GCCGTCTTTCTCTTT
Genomic location of TG539  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D631 marker 631
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)