SGN Marker CT19

SGN-M632

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT19 image not available
Forward sequence
not available
Reverse sequence
GCCCCAAAACTCCTGCTGGATTTTACTGGATCTCCACTTGCTGCGGACATTGCTTGCCTCCGACAATCATCTTCCCAACTTCTTCCTTTT
TGTCTTGAAATTAATCCCTTGTACCCATTGCTGCTTCTAAATGACCTCCTGCATCCCGGCGGATCCACTAGGTCTAAAGCTGCCGCCCCC
GC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51874)
Chromosome
12
Position
42.01 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51875)
Chromosome
7
Position
23.93 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42315)
Chromosome
10
Position
35.60 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39008)
Chromosome
12
Position
15.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39009)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39002)
Chromosome
12
Position
13.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9679)
Chromosome
10
Position
27.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9678)
Chromosome
12
Position
7.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT19 was used as an overgo probe on plate 3 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTCCACTTGCTGCGGACATTGC
B sequence
TGATTGTCGGAGGCAAGCAATGTC
AB sequence
ATCTCCACTTGCTGCGGACATTGCTTGCCT
Marker sequence
GCCCCAAAACTCCTGCTGGATTTTACTGGATCTCCACTTGCTGCGGACAT
TGCTTGCCTCCGACAATCATCTTCCCAACTTCTTCCTTTTTGTCTTGAAA
TTAATCCCTTGTACCCATTGCTGCTTCTAAATGACCTCCTGCATCCCGGC
GGATCCACTAGGTCTAAAGCTGCCGCCCCCGC
Genomic location of CT19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D632 marker 632
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)