SGN Marker TG545

SGN-M633

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG545 image not available
Forward sequence
not available
Reverse sequence
TATAGGGAGACAAGCTTGCATGCCTGCAGCTGATGAGGTTGCAAATAGTTGCAGCCTAAACAACCATTTATTTTGCAGTACTGACAACGC
TCTGTTTCTTCCGGTACGCGAAACAAGGGCGGCGACATACCACTCGTACAAGGAAATGATGAAATAGTTGCAGCACCAGTAATCACATTG
GTTAAAGCAGCAACCATGATTGAAAACTCTTCTTCACCACTAAGTTTTGTTGACCTCTGCATTGTTGAAAAAACAGAGAAAATGTTTGGT
CTTTGGATGGGTTTTTTTTTAAAAGTAACTTATATAGTTGAGAAATGAAGATGAGTACACTTATTGTACACGGGGTTTGATTTTTAGCTT
AGCTGACATCTTCACGTGGGATATTTTGGGTAATAGTTGATGACGTGGAAGAAAATGGATGGCGTTCACATGGTGAATGTCACTTTCCTG
GACCATCTTGTAGGAGGAATAATGACGTAATGTCTTACATTACACAAAGAAGGGTAATTTTGGAATTTAGGGAAGACAGGGGACTGTTTG
GCAGTCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1530367.1e-90194 (35.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9688)
Chromosome
10
Position
32.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG545 was used as an overgo probe on plate 16 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGATGGCGTTCACATGGTGAATG
B sequence
TGGTCCAGGAAAGTGACATTCACC
AB sequence
TGGATGGCGTTCACATGGTGAATGTCACTT
Marker sequence
TATAGGGAGACAAGCTTGCATGCCTGCAGCTGATGAGGTTGCAAATAGTT
GCAGCCTAAACAACCATTTATTTTGCAGTACTGACAACGCTCTGTTTCTT
CCGGTACGCGAAACAAGGGCGGCGACATACCACTCGTACAAGGAAATGAT
GAAATAGTTGCAGCACCAGTAATCACATTGGTTAAAGCAGCAACCATGAT
TGAAAACTCTTCTTCACCACTAAGTTTTGTTGACCTCTGCATTGTTGAAA
AAACAGAGAAAATGTTTGGTCTTTGGATGGGTTTTTTTTTAAAAGTAACT
TATATAGTTGAGAAATGAAGATGAGTACACTTATTGTACACGGGGTTTGA
TTTTTAGCTTAGCTGACATCTTCACGTGGGATATTTTGGGTAATAGTTGA
TGACGTGGAAGAAAATGGATGGCGTTCACATGGTGAATGTCACTTTCCTG
GACCATCTTGTAGGAGGAATAATGACGTAATGTCTTACATTACACAAAGA
AGGGTAATTTTGGAATTTAGGGAAGACAGGGGACTGTTTGGCAGTCA
Genomic location of TG545  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D633 marker 633
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)