SGN Marker TG553

SGN-M635

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG553 image not available
Forward sequence
not available
Reverse sequence
TGCATGCCTGCAGATATCTAAATTTGTTAGCATTATTATTACGGAATGTGTTCGGTAAAATTTAATAATTTTAATACAATTTTTTAAATA
TTTTAAATATATGTGAAGTTAGAACTGAAAATGAAGTTTTAAAATGTATTTGGTTGTGATTGTTTTAATATATTTCGCTTTTATAAGCTA
TAAGGATATATAATTGTACCAAACAAACATATATTAAAAAACCATCATTGACTATTCCACGAAGTCAATGAAATAAATTTTCGTACCAAA
CACACCCCCAAAAAATATTTTATTATTTCATTTATCGAGGGAAACTAACATTGAATGGAGCTCTATTACTATTAAGCTTTTTTAAAACAA
GGCTAAAATTTAAACATAATATTGAATATTTTATTTGTGCACATTAAAAAGGCAAACTCGTTGAACATCAAATTCTTAATCATGTGTATT
ATCTTGACAAAATGAAGTGTATCTATGATAAGGATAAGGATAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9689)
Chromosome
8
Position
54.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9690)
Chromosome
8
Position
70.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG553 was used as an overgo probe on plate 12 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCACGAAGTCAATGAAATAAATTT
B sequence
GGTGTGTTTGGTACGAAAATTTAT
AB sequence
CCACGAAGTCAATGAAATAAATTTTCGTAC
Marker sequence
TGCATGCCTGCAGATATCTAAATTTGTTAGCATTATTATTACGGAATGTG
TTCGGTAAAATTTAATAATTTTAATACAATTTTTTAAATATTTTAAATAT
ATGTGAAGTTAGAACTGAAAATGAAGTTTTAAAATGTATTTGGTTGTGAT
TGTTTTAATATATTTCGCTTTTATAAGCTATAAGGATATATAATTGTACC
AAACAAACATATATTAAAAAACCATCATTGACTATTCCACGAAGTCAATG
AAATAAATTTTCGTACCAAACACACCCCCAAAAAATATTTTATTATTTCA
TTTATCGAGGGAAACTAACATTGAATGGAGCTCTATTACTATTAAGCTTT
TTTAAAACAAGGCTAAAATTTAAACATAATATTGAATATTTTATTTGTGC
ACATTAAAAAGGCAAACTCGTTGAACATCAAATTCTTAATCATGTGTATT
ATCTTGACAAAATGAAGTGTATCTATGATAAGGATAAGGATAAG
Genomic location of TG553  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D635 marker 635
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)