SGN Marker TG43

SGN-M638

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG43 image not available
Forward sequence
not available
Reverse sequence
GATTTTCCGTCAGATTTCCATATCTACTTTCATCTGGCTGAACCTCAATGTCAACACACTGCAAAAGAAATTTCAACACAAAATTGCAGC
TGATCCCAAGTTCTCCACTTCTTATGCCTAGGTAAAAACACAGCTGGGAATGACCTTCATATTCTTTTGCTTTAATTTTAAACTCAAATC
CATACAATATTATACTTATACAAGTCAATTAGGAAATATCAAACCAGTGTAAAATTAACACTTTTTAACTAGATATCCTTTCACAACCTA
GACGCAGGTCATTACACCAAGTCAAGAAGCAAGTCAGTCTAGTCCTACTAAATGCGGGGCACTGGAAATTGTTCTGAGAGAATGAATCAT
CAAGAGGAAGAACTTCAAAGAAAATCCTGACTAACAATAGTATTTAAGGTAATAGTAAACATATGCCAAGTTAGTTCCGATCAAAACACT
GATTGACGTTCTAAAGCTAAGGTCATGTAAAAATGCAAAAGGCTTGAGCAACATTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53321)
Chromosome
10
Position
45.24 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53322)
Chromosome
9
Position
76.93 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53315)
Chromosome
10
Position
49.39 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9691)
Chromosome
10
Position
32.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9692)
Chromosome
10
Position
7.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG43 was used as an overgo probe on plate 15 [well G7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P318K23,   P267N03,   P047L21,   P242N18,   P302B15,   P156N03,   P326K06,   P257H09,   P174G23,   P197B18,   P113B23

 Overgo Sequences

A sequence
ATTGCAGCTGATCCCAAGTTCTCC
B sequence
CCTAGGCATAAGAAGTGGAGAACT
AB sequence
ATTGCAGCTGATCCCAAGTTCTCCACTTCT
Marker sequence
GATTTTCCGTCAGATTTCCATATCTACTTTCATCTGGCTGAACCTCAATG
TCAACACACTGCAAAAGAAATTTCAACACAAAATTGCAGCTGATCCCAAG
TTCTCCACTTCTTATGCCTAGGTAAAAACACAGCTGGGAATGACCTTCAT
ATTCTTTTGCTTTAATTTTAAACTCAAATCCATACAATATTATACTTATA
CAAGTCAATTAGGAAATATCAAACCAGTGTAAAATTAACACTTTTTAACT
AGATATCCTTTCACAACCTAGACGCAGGTCATTACACCAAGTCAAGAAGC
AAGTCAGTCTAGTCCTACTAAATGCGGGGCACTGGAAATTGTTCTGAGAG
AATGAATCATCAAGAGGAAGAACTTCAAAGAAAATCCTGACTAACAATAG
TATTTAAGGTAATAGTAAACATATGCCAAGTTAGTTCCGATCAAAACACT
GATTGACGTTCTAAAGCTAAGGTCATGTAAAAATGCAAAAGGCTTGAGCA
ACATTC
Genomic location of TG43  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D638 marker 638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)