SGN Marker TG216

SGN-M64

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1770
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATTCCATGTGATTAATTATTTAAAGGTCTCTGTTTCAAACCCGAGTAGCAACATTTCCCTTATCATTAAAAAAAGAAAAAAGGAATTTC
ATCTGAAAAAATTCATAGGGAGGAAACTTTAGAGGGATAATGCAATGAGGATCAGAATTGGTTACAATGTTCTTCTGTATTTATCTGTCT
TTAGTATTGTGTAAAGCAGGTAATATGTGTGAACTTTTGATATGCTTGAAGTACTCTTCTGCTTTTATGGGGAAAACTTGTCCCCCTTTT
TTCTGCGATATGGATATCACATATTAATTTTGTGTGGGTCGAATAATTCATTGATGGAATATAAAAAGCAATTGATGTTCATTTACTTAT
TTGACAGGGGCGTGCTCTATATCATATATCAAAAGCTTTCGGTACTGCATCCTCAAAATTGGAAAAGATTGGATATGGTATCTTGATATC
TCATTCCTTAAATTTTCCATCCTTTAA
Reverse sequence
GAAGCTGCACAAATAAAAATAAGTATCTCCATTTTAGAACTTGATCTATTGAATTTCAACACAAATATCCCCGTAAATGAAGCCTGGGAT
TGCAAATAAAATTTCAGAATACTTCCAAGATAACTACTTCACAACTCAAATGAAGCTACTTGACTTAAGATTAAGATTGACGACCTCATA
CTTTTAAAATGAACTGGACAAGATTAATTGGTTAATCTAGGGTAAGAAAGCTCCATGCAGACCATACAAGGAATTACATTTACCTTCCGG
TGTAGAGAAGCAAGGATGTGATCAACTCGCTTAAGTTCCTTGAAGTCGATGGCCTCTTTGGCGGGCTTAGTTTCAGATGCTTGGCTATTG
TTTTCCGACTCCACTGCAAAAAGAATTTATTGAATGGGATCAACATAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1539042.3e-1260 (12.6% of RFLP seq)+
SGN-U1631751.9e-3473 (15.3% of RFLP seq)+
SGN-U1539041.2e-1081 (19.9% of RFLP seq)-
SGN-U1631752.8e-39111 (27.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53219)
Chromosome
7
Position
18.83 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42418)
Chromosome
7
Position
95.80 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39943)
Chromosome
7
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7928)
Chromosome
7
Position
106.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7927)
Chromosome
7
Position
59.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG216 was used as an overgo probe on plate 7 [well C12]

Plausible BAC Matches:   P320P17,   P241F16,   P266D21,   P201H13,   P112P22

 Non-Plausible BAC matches

P046C02,   P221O11,   P067O03,   P327B08,   P021L13,   P297E16,   P267A19,   P079K08

 Overgo Sequences

A sequence
TAAAGGTCTCTGTTTCAAACCCGA
B sequence
AGGGAAATGTTGCTACTCGGGTTT
AB sequence
TAAAGGTCTCTGTTTCAAACCCGAGTAGCA
Marker sequence
AATTCCATGTGATTAATTATTTAAAGGTCTCTGTTTCAAACCCGAGTAGC
AACATTTCCCTTATCATTAAAAAAAGAAAAAAGGAATTTCATCTGAAAAA
ATTCATAGGGAGGAAACTTTAGAGGGATAATGCAATGAGGATCAGAATTG
GTTACAATGTTCTTCTGTATTTATCTGTCTTTAGTATTGTGTAAAGCAGG
TAATATGTGTGAACTTTTGATATGCTTGAAGTACTCTTCTGCTTTTATGG
GGAAAACTTGTCCCCCTTTTTTCTGCGATATGGATATCACATATTAATTT
TGTGTGGGTCGAATAATTCATTGATGGAATATAAAAAGCAATTGATGTTC
ATTTACTTATTTGACAGGGGCGTGCTCTATATCATATATCAAAAGCTTTC
GGTACTGCATCCTCAAAATTGGAAAAGATTGGATATGGTATCTTGATATC
TCATTCCTTAAATTTTCCATCCTTTAA
Genomic location of TG216  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D64 marker 64
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)