Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TG568

SGN-M640

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pGEM4Z
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TAAAGCTAATATATTTTTATATGCAAAAAGGTACCGCATCATTCTTTTTGGGACAAATTAAAAGGTAAACCACATCACATAAATTGGGTC
AAAGGGAAAACCATATTAGAGAGGGACCATGTCTTACCCCTAAATGTGTTACAACATAGAATAATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9694)
Chromosome
9
Position
50.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG568 was used as an overgo probe on plate 14 [well G11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P005N10,   P008O03,   P041O05,   P334D14,   P328I05,   P297G23,   P255A24,   P141D19,   P267P10,   P243H15,   P100E22,   P127F17,   P124L03,   P271C10,   P209C10,   P001M04,   P266P10,   P008I14,   P134M18,   P258L01,   P146P16

 Overgo Sequences

A sequence
GGGTCAAAGGGAAAACCATATTAG
B sequence
AAGACATGGTCCCTCTCTAATATG
AB sequence
GGGTCAAAGGGAAAACCATATTAGAGAGGG
Marker sequence
TAAAGCTAATATATTTTTATATGCAAAAAGGTACCGCATCATTCTTTTTG
GGACAAATTAAAAGGTAAACCACATCACATAAATTGGGTCAAAGGGAAAA
CCATATTAGAGAGGGACCATGTCTTACCCCTAAATGTGTTACAACATAGA
ATAATG
Genomic location of TG568  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D640 marker 640
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)