Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker CT103

SGN-M642

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT103 image not available
Forward sequence
not available
Reverse sequence
CACCTGTAATGCTCTTCATGAAGGGTACACCAGATTCTCCAAGATGTGGTTTCACCTCCAAGGTGGTAAATGCCTTGAAGGAGGAAGGGG
TTGATTTTGGATCCTTTGATATTCTATCCGACGAACAAGTAAGGCAGGGACTGAAGACCTTCTCTAACTGGCCAACTTATCCGCAGCTGT
ATTACAAAGGCGAACTTGTAGGAGGATGTGATATCGTGCTGGAATTACATAGCGGGGGTGAATTGAAGTCAACATTATCTGAATAGAAGA
ACCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1553742e-150275 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53756)
Chromosome
2
Position
40.20 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53440)
Chromosome
2
Position
47.94 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42947)
Chromosome
2
Position
40.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43947
Forward primer (5'-3')
TTGAAGGAGGAAGGGGTTGATT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GAAAGCAGAATCAACCATAGGCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38957)
Chromosome
2
Position
63.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9696)
Chromosome
2
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT103 was used as an overgo probe on plate 16 [well G6]

Plausible BAC Matches:   P124F09,   P136D24,   P134D24

 Overgo Sequences

A sequence
GAAGGGTACACCAGATTCTCCAAG
B sequence
GGAGGTGAAACCACATCTTGGAGA
AB sequence
GAAGGGTACACCAGATTCTCCAAGATGTGG
Marker sequence
CACCTGTAATGCTCTTCATGAAGGGTACACCAGATTCTCCAAGATGTGGT
TTCACCTCCAAGGTGGTAAATGCCTTGAAGGAGGAAGGGGTTGATTTTGG
ATCCTTTGATATTCTATCCGACGAACAAGTAAGGCAGGGACTGAAGACCT
TCTCTAACTGGCCAACTTATCCGCAGCTGTATTACAAAGGCGAACTTGTA
GGAGGATGTGATATCGTGCTGGAATTACATAGCGGGGGTGAATTGAAGTC
AACATTATCTGAATAGAAGAACCCC
Genomic location of CT103  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D642 marker 642
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)