SGN Marker TG575

SGN-M643

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG575 image not available
Forward sequence
not available
Reverse sequence
CTGCCACACAACTCAAGGGTATTTTAGTTCGGAATTAATTCATTGAACTTAAAACCACACAAGTTCTATTTGGGTGTTGGGTCGAATGAA
CACTCCCAAGCTACAACAAAGACCAAGAAACCAGTTCAATATATAAAAAATAAGCAAAGAGCTAGATGTCTTGGAAGTAATATTTGCAAA
ATTTTCAGTCAAAAACAGCAAGATGCTCTGTGCAAAAGATAAACAAATTGATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1652823.5e-3175 (32.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9698)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG575 was used as an overgo probe on plate 5 [well C3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P128K17,   P106N16,   P150K04,   P233H12,   P318G20,   P001E20,   P016D05,   P318H14,   P070K13,   P068N01,   P208A03,   P054N18,   P106N20,   P227C18,   P207P09

 Overgo Sequences

A sequence
TCTATTTGGGTGTTGGGTCGAATG
B sequence
GTAGCTTGGGAGTGTTCATTCGAC
AB sequence
TCTATTTGGGTGTTGGGTCGAATGAACACT
Marker sequence
CTGCCACACAACTCAAGGGTATTTTAGTTCGGAATTAATTCATTGAACTT
AAAACCACACAAGTTCTATTTGGGTGTTGGGTCGAATGAACACTCCCAAG
CTACAACAAAGACCAAGAAACCAGTTCAATATATAAAAAATAAGCAAAGA
GCTAGATGTCTTGGAAGTAATATTTGCAAAATTTTCAGTCAAAAACAGCA
AGATGCTCTGTGCAAAAGATAAACAAATTGATT
Genomic location of TG575  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D643 marker 643
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)