SGN Marker CT55

SGN-M644

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT55 image not available
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTTTTGATTTTATCAAAAGATTTCATTCAGAATCTGTAAGCTCTGCAATTGAAATAAGGTCCGCCCAAACAAAACAGTAA
TAATCCTTCAACAAGGGAAACGAGTGTGGGGTTTTTAAACTTTGACCCACTCTAAGATTTTTCGAATTATTACAAAAAAAGTCAAAAGGA
AAAATGATAAATGTCTCCCCAACTGAATACTCAAATGTAACAACAAAAAGATTTTCATCACCATCTAAATTCTAAAGGATGTTACGAGGC
TGACTTATGCACCACCAGATCCGTATTTCTTTCCCAAAACAAGAACCTGAAGCTTGTCATATCCAGCCAACACACCAGCACCAGCAACAG
CTCGGAGGATGTTAGCACCAGCACCCTTGAACAGAGATTTGGGACCCTCATTCTTAACAATCTGGGAGAATGCATCAAGCGAGCTCCTGT
ACTTCACCGCCTCACCAGATGTCATCATCATTCTTCTTCTTACTGTATCAATGGGGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1584172.3e-0650 (9.8% of RFLP seq)-
SGN-U1585642.8e-21167 (32.9% of RFLP seq)-
SGN-U1605072e-139289 (56.9% of RFLP seq)-
SGN-U143394493 (97.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53473)
Chromosome
12
Position
31.72 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53474)
Chromosome
11
Position
40.57 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51900)
Chromosome
11
Position
38.63 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39058)
Chromosome
11
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9700)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9699)
Chromosome
11
Position
25.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT55 was used as an overgo probe on plate 10 [well C7]

Plausible BAC Matches:   P173N18,   P095I03,   P210P03,   P169E21,   P201D24,   P092P03,   P329K07,   P282P08,   P131N16,   P196C17,   P178I15,   P167A10,   P210H22,   P330P05,   P219L06,   P114N01,   P327L13,   P245M17,   P216O03,   P105P09,   P151K01,   P122H07,   P268H23,   P236O10,   P160P03,   P016J23,   P240P16,   P283N24,   P076O21,   P031D20,   P171P15,   P158J02,   P029K07,   P141J06,   P057A24,   P315G04,   P225N16,   P262D02,   P114P04,   P233B18,   P276N14,   P164I14,   P288B16,   P117I01,   P306J05,   P090L21,   P273I21,   P300M05,   P272O02,   P222B08,   P332F14,   P265D01,   P300I10,   P211A17,   P223P19,   P267K05,   P106K19

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATGTTAGCACCAGCACCCTTGAAC
B sequence
AGGGTCCCAAATCTCTGTTCAAGG
AB sequence
ATGTTAGCACCAGCACCCTTGAACAGAGAT
Marker sequence
TTTTTTTTTTTTTTTGATTTTATCAAAAGATTTCATTCAGAATCTGTAAG
CTCTGCAATTGAAATAAGGTCCGCCCAAACAAAACAGTAATAATCCTTCA
ACAAGGGAAACGAGTGTGGGGTTTTTAAACTTTGACCCACTCTAAGATTT
TTCGAATTATTACAAAAAAAGTCAAAAGGAAAAATGATAAATGTCTCCCC
AACTGAATACTCAAATGTAACAACAAAAAGATTTTCATCACCATCTAAAT
TCTAAAGGATGTTACGAGGCTGACTTATGCACCACCAGATCCGTATTTCT
TTCCCAAAACAAGAACCTGAAGCTTGTCATATCCAGCCAACACACCAGCA
CCAGCAACAGCTCGGAGGATGTTAGCACCAGCACCCTTGAACAGAGATTT
GGGACCCTCATTCTTAACAATCTGGGAGAATGCATCAAGCGAGCTCCTGT
ACTTCACCGCCTCACCAGATGTCATCATCATTCTTCTTCTTACTGTATCA
ATGGGGTA
Genomic location of CT55  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D644 marker 644
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)