SGN Marker CT114

SGN-M645

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TCCGACGAAATTAACGATTGAAGAATGGCGGTGAAGAAGAGTGTCGGATCACTGAAAGAAGCAGATCTGAAAGGGAAGAGAGTATTCGTC
CGAGTTGATCTCAACGTTCCATTGGATGATAACTTCAAAATCACTGATGACACCAGAATCCGGGCTGCTGTACCTACCATCAAGTACTTG
ATGCAAAATGGTGCCAGAGTCATCCTTGCCTCTCATCTTGGTCGCCCCAAAGGTGTCACTCCAAAGTACAGCTTAAAGCCACTTGTGCCT
AGACTTTCAACAACTATTGGGAATCGAGGTCAAGATGGCAAATGATTCAGTTGGCCCAGAAGTTGAGAAACTTGGTGGCTGGACTACCGG
AAGGAGGAGTTGTACTTCTGGAGAATGTGCGATTTTACAAAGAAGAGGAGAAGAATGACCCCGAGTTTGCCAAGAAGTTGGCATCTCTTG
CAGATTTGTACGTCAATGATGCATTTGGGACTGCTCACAGAGCCCATGCTTCCACGGAAGGGGTTGCTAAGGTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1440363.8e-08125 (23.9% of RFLP seq)-
SGN-U1607841.7e-90175 (33.4% of RFLP seq)-
SGN-U143816524 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42948)
Chromosome
7
Position
64.20 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43948
Forward primer (5'-3')
GGCGGTGAAGAAGAGTGTCGGAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCATAAGAATCCAGCAACGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38966)
Chromosome
7
Position
96.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9703)
Chromosome
7
Position
88.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35567
Forward primer (5'-3')
ATTGAAGAATGGCGGTGAAG
Digested band sizes (using DraI)
Solanum pennellii LA716: 325+800
Solanum lycopersicum LA925: 300+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCCAACTTCTTGGCAAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1125
Solanum lycopersicum LA925: 1125
Approximate temperature
60°C
  
PCR data   Exp. ID 97
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum pennellii LA716: 325+800
Solanum lycopersicum LA925: 300+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1125
Solanum lycopersicum LA925: 1125
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
CT114 was used as an overgo probe on plate 7 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCAAAATGGTGCCAGAGTCATCC
B sequence
CCAAGATGAGAGGCAAGGATGACT
AB sequence
TGCAAAATGGTGCCAGAGTCATCCTTGCCT
Marker sequence
TCCGACGAAATTAACGATTGAAGAATGGCGGTGAAGAAGAGTGTCGGATC
ACTGAAAGAAGCAGATCTGAAAGGGAAGAGAGTATTCGTCCGAGTTGATC
TCAACGTTCCATTGGATGATAACTTCAAAATCACTGATGACACCAGAATC
CGGGCTGCTGTACCTACCATCAAGTACTTGATGCAAAATGGTGCCAGAGT
CATCCTTGCCTCTCATCTTGGTCGCCCCAAAGGTGTCACTCCAAAGTACA
GCTTAAAGCCACTTGTGCCTAGACTTTCAACAACTATTGGGAATCGAGGT
CAAGATGGCAAATGATTCAGTTGGCCCAGAAGTTGAGAAACTTGGTGGCT
GGACTACCGGAAGGAGGAGTTGTACTTCTGGAGAATGTGCGATTTTACAA
AGAAGAGGAGAAGAATGACCCCGAGTTTGCCAAGAAGTTGGCATCTCTTG
CAGATTTGTACGTCAATGATGCATTTGGGACTGCTCACAGAGCCCATGCT
TCCACGGAAGGGGTTGCTAAGGTC
Genomic location of CT114  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D645 marker 645
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)