SGN Marker TG222

SGN-M646

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGGTGTACTTATTGTTCTAACAACTTTACACTTGATGGTGACAAAACCAAATTCAGTGACATCAAAGGC
TACAGGTAATTGGGAAAAAAAAAATTCTGTTATTTTGGTAATTAAATCTGTAAATTTGCTAATAATTTAATTTAAGTACAGGCATGTGTT
AGCAGCGGCAGCAGGGGGAGTGCTTTATTCATTAATTCAGCTGCCTTTCGCATTGTATCAAGCTGTGAAGGAAAAGAGATTGATCAATGG
CCAGTTTCTCCCCGTGTTTGATTTTTACGGAGATAAGGTTTGTGCCCAGTCTTTAATACAATTAAGACAAAATAGCTTTTACCATATATA
GTACTTTTGTTTTTAAACTGAAATAACTTAAAGGTTAATGTATAAGCCGTAAGTTACAAGTCTATCCAAAAATATTTTTAATGTACAAAG
ATCATACACATGCTTTCCATTAGGGATCACCAAACTTTCTCGACATTCTTTTATGTATAAATATTGATTTTGAATCTTCTGAACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9707)
Chromosome
3
Position
58.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG222 was used as an overgo probe on plate 14 [well B2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P294G01,   P294H11,   P276J19,   P011F13,   P171C10

 Overgo Sequences

A sequence
AGCTGCCTTTCGCATTGTATCAAG
B sequence
CTCTTTTCCTTCACAGCTTGATAC
AB sequence
AGCTGCCTTTCGCATTGTATCAAGCTGTGA
Marker sequence
GGAGACAGCTTGCATGCCTGCAGGTGTACTTATTGTTCTAACAACTTTAC
ACTTGATGGTGACAAAACCAAATTCAGTGACATCAAAGGCTACAGGTAAT
TGGGAAAAAAAAAATTCTGTTATTTTGGTAATTAAATCTGTAAATTTGCT
AATAATTTAATTTAAGTACAGGCATGTGTTAGCAGCGGCAGCAGGGGGAG
TGCTTTATTCATTAATTCAGCTGCCTTTCGCATTGTATCAAGCTGTGAAG
GAAAAGAGATTGATCAATGGCCAGTTTCTCCCCGTGTTTGATTTTTACGG
AGATAAGGTTTGTGCCCAGTCTTTAATACAATTAAGACAAAATAGCTTTT
ACCATATATAGTACTTTTGTTTTTAAACTGAAATAACTTAAAGGTTAATG
TATAAGCCGTAAGTTACAAGTCTATCCAAAAATATTTTTAATGTACAAAG
ATCATACACATGCTTTCCATTAGGGATCACCAAACTTTCTCGACATTCTT
TTATGTATAAATATTGATTTTGAATCTTCTGAACA
Genomic location of TG222  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D646 marker 646
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)