SGN Marker C2_At1g01730

SGN-M6466
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303612 (SGN)
124202 (CGN)
---
Capsicum annuumSingleSGN-U203465---
Lycopersicon CombinedSingleSGN-U221075---
Solanum tuberosumSingleSGN-U247957---
ArabidopsisSingleAt1g01730 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38046)
Chromosome
10
Position
33.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39352
Forward primer (5'-3')
TCCCTCAGATATTAGTAACAGAAAGAG
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TTGCAATTGCGGAAGTCAGGAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
850
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24861)
Chromosome
1
Position
0.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9868
Forward primer (5'-3')
TCCCTCAGATATTAGTAACAGAAAGAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTGCAATTGCGGAAGTCAGGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 390
Approximate temperature
53°C
  
PCR data   Exp. ID 9869
Forward primer (5'-3')
TCCCTCAGATATTAGTAACAGAAAGAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTGCAATTGCGGAAGTCAGGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 390
Approximate temperature
53°C
  
PCR data   Exp. ID 9870
Forward primer (5'-3')
TCCCTCAGATATTAGTAACAGAAAGAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TTGCAATTGCGGAAGTCAGGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 390
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At1g01730F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g01730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6466 marker 6466
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)