SGN Marker TG228

SGN-M647

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
4010
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG228 image not available
Forward sequence
not available
Reverse sequence
TTGGGGACCAACATCATTGTAAAGATAGATTTCAGGAAGACTGACATCTTTCTGAGGATTGAAACCTTCCGAGGAGTTGGCATTACACAA
AACCCTTATTGATGTATTGTACAGGAAATCATTGCCCTTTGAAGTAACAGGAGCCTGAAATAAGTGTAGCAACAGGCAGACCATGTGTCA
AAAGATATAATAATTAGCCATAAACAAAAGTAGTAGAGTAGTAATAAATTAAGCTCACCCAATCATGGCAAGAAAGCATGAAATGATCAG
CTCCATGGGTTCGATTCCAGAATGGGTATTTAGTTGATATAAGTCGGACATAATCAGAGACGTACTGTTTAAGAGGTGCAAGATTATATG
AAAGAGGGACGTAGAGAAACTTAACCATCCAAGCTACACTAAAAGGCATGAAGTAAACATGGGCTGAATGAGGGTCTCTTGTCCTGAATT
TATTGTTACCATATTCCATCTCACTGATGAACCTTCCCTCACTAGCATATATATCTTTACACGGTCCATTATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9708)
Chromosome
8
Position
14.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG228 was used as an overgo probe on plate 12 [well C6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P266B05,   P329I12,   P033I22,   P298I20,   P033K05,   P326O06,   P265B22,   P202C23,   P290P08,   P267B05,   P119M06,   P121M08

 Overgo Sequences

A sequence
GGATTGAAACCTTCCGAGGAGTTG
B sequence
GGGTTTTGTGTAATGCCAACTCCT
AB sequence
GGATTGAAACCTTCCGAGGAGTTGGCATTA
Marker sequence
TTGGGGACCAACATCATTGTAAAGATAGATTTCAGGAAGACTGACATCTT
TCTGAGGATTGAAACCTTCCGAGGAGTTGGCATTACACAAAACCCTTATT
GATGTATTGTACAGGAAATCATTGCCCTTTGAAGTAACAGGAGCCTGAAA
TAAGTGTAGCAACAGGCAGACCATGTGTCAAAAGATATAATAATTAGCCA
TAAACAAAAGTAGTAGAGTAGTAATAAATTAAGCTCACCCAATCATGGCA
AGAAAGCATGAAATGATCAGCTCCATGGGTTCGATTCCAGAATGGGTATT
TAGTTGATATAAGTCGGACATAATCAGAGACGTACTGTTTAAGAGGTGCA
AGATTATATGAAAGAGGGACGTAGAGAAACTTAACCATCCAAGCTACACT
AAAAGGCATGAAGTAAACATGGGCTGAATGAGGGTCTCTTGTCCTGAATT
TATTGTTACCATATTCCATCTCACTGATGAACCTTCCCTCACTAGCATAT
ATATCTTTACACGGTCCATTATG
Genomic location of TG228  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D647 marker 647
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)