SGN Marker CT73

SGN-M648

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT73 image not available
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGGGGAATTGCCCTCCAAAATCAAAAAAAA
ATTTGCCCCCTTTTTCCTTCATAAACCCTTTTAACCCTGAAAAAAATTTTTTTTTAAAAACCCTACTTCCTAATTCCCCACCTTCCGCGG
GGAAACCAACAAATTTTTAACCTGTTCCCCCCCAAAAAATTGGGCCCCATTTACACCTGAAACTTTTTTGGAAACCCCCCCGGGGCCCCC
CAAGCTGGGCCCCCCCCCCCCGGTAAGGGAAAAAGGAAAAAGTTCCCCTTCTTCCTGAAAACCGGGGTTGGTAATTCCCAAGAACAGCTT
TTTCTCCGAAAATTTTCCCCCCATAAAATTGCCAAAACCCCATATAGGGGCCCTTGAAAAAAACAATCCCCCCGGGGGAATAAAAAAAAC
CCCCCCCCAAGTTGTTCAAATTGGGGAACCAACAACCGCCCCTGGGAAGGGAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1460995.8e-0747 (9.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39067)
Chromosome
4
Position
103.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9709)
Chromosome
4
Position
106.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT73 was used as an overgo probe on plate 7 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTTCCCCTTCTTCCTGAAAACCG
B sequence
TGGGAATTACCAACCCCGGTTTTC
AB sequence
AGTTCCCCTTCTTCCTGAAAACCGGGGTTG
Marker sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTGGGGGGAATTGCCCTCCAAAATCAAAAAAAAATTTGCCCCC
TTTTTCCTTCATAAACCCTTTTAACCCTGAAAAAAATTTTTTTTTAAAAA
CCCTACTTCCTAATTCCCCACCTTCCGCGGGGAAACCAACAAATTTTTAA
CCTGTTCCCCCCCAAAAAATTGGGCCCCATTTACACCTGAAACTTTTTTG
GAAACCCCCCCGGGGCCCCCCAAGCTGGGCCCCCCCCCCCCGGTAAGGGA
AAAAGGAAAAAGTTCCCCTTCTTCCTGAAAACCGGGGTTGGTAATTCCCA
AGAACAGCTTTTTCTCCGAAAATTTTCCCCCCATAAAATTGCCAAAACCC
CATATAGGGGCCCTTGAAAAAAACAATCCCCCCGGGGGAATAAAAAAAAC
CCCCCCCCAAGTTGTTCAAATTGGGGAACCAACAACCGCCCCTGGGAAGG
GAAAAA
Genomic location of CT73  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D648 marker 648
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)