Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker CT74

SGN-M649

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT74 image not available
Forward sequence
not available
Reverse sequence
AGAAAAAGATGACTAATTTTTTTGTTGCTTTTGTAAATGTTTAGTGTTGATGATGACTATTGAGGTCTCATGTCGGTTCTCAGATATGAT
GGATTCTTCTTGTTGAAAGAAAGTTGCTTTATTCATCCTTGGATCTTTGCTTTTTTGGTACAAATTAGTTTCTGGGGTTGCTTAAAAGTT
GAATCTTGATGGTGTTTTCAAGCTGAAATAATCAAGGAATAAGAAGAAGTTCAAGATCAGAATTTTTTAAGCAAAGTTTATAATGGCAGA
TTATAATTCTTTACCCTTTCCAATGGAGAATTCAAGAAAAACCTCTTCTTTTTTTGGTTCACCAAGGTTGTTTACTTGTTTTGCTGCTAA
GGGGTTTCCTGATACTGAGTCTATTATGAGTCCTACTTCAATTCTTGATAGTAAACCTTTCACTGTTCTGAGAAACCCCTTTTGGTCTGA
GCCAAAATCTCCCTAACCAGAAAGTAGAGTTCATTTTCAGAAACTTGACTCAAAAGGGGTTGGTCTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U144795518 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49347)
Chromosome
9
Position
63.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47283)
Chromosome
9
Position
64.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43657)
Chromosome
9
Position
57.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43515)
Chromosome
9
Position
64.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43057)
Chromosome
9
Position
71.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42357)
Chromosome
9
Position
78.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39068)
Chromosome
9
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9713)
Chromosome
9
Position
61.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9715)
Chromosome
9
Position
86.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9714)
Chromosome
9
Position
75.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9719)
Chromosome
9
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT74 was used as an overgo probe on plate 14 [well G9]

Plausible BAC Matches:   P329I18

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTGTTGATGATGACTATTGAGGTC
B sequence
CTGAGAACCGACATGAGACCTCAA
AB sequence
GTGTTGATGATGACTATTGAGGTCTCATGT
Marker sequence
AGAAAAAGATGACTAATTTTTTTGTTGCTTTTGTAAATGTTTAGTGTTGA
TGATGACTATTGAGGTCTCATGTCGGTTCTCAGATATGATGGATTCTTCT
TGTTGAAAGAAAGTTGCTTTATTCATCCTTGGATCTTTGCTTTTTTGGTA
CAAATTAGTTTCTGGGGTTGCTTAAAAGTTGAATCTTGATGGTGTTTTCA
AGCTGAAATAATCAAGGAATAAGAAGAAGTTCAAGATCAGAATTTTTTAA
GCAAAGTTTATAATGGCAGATTATAATTCTTTACCCTTTCCAATGGAGAA
TTCAAGAAAAACCTCTTCTTTTTTTGGTTCACCAAGGTTGTTTACTTGTT
TTGCTGCTAAGGGGTTTCCTGATACTGAGTCTATTATGAGTCCTACTTCA
ATTCTTGATAGTAAACCTTTCACTGTTCTGAGAAACCCCTTTTGGTCTGA
GCCAAAATCTCCCTAACCAGAAAGTAGAGTTCATTTTCAGAAACTTGACT
CAAAAGGGGTTGGTCTTG
Genomic location of CT74  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D649 marker 649
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)