SGN Marker CT47

SGN-M65

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT47 image not available
Forward sequence
CGTTATAATGAGGCCCCTCCCTAATATTGGCAAAGGGCTGGTCACTAGTCAGCGATGGCTTGTCCCAGGGTTTAGAAGGCAGATGAAAAC
TAGTTGAGGATGCATCTTCGCCAAAAGATGTAATAGGATATCCTGTCTTTTCAACAAAACTAGTACCATTAATGCGATTAGGAGATAACT
CCAGCTGGTCCTTCAACATGAAGCCACTGCCAGTTGAGGCAGGGAATATTGAAGCTTCATTGACATCAGTTACTGATAATCTAGAAAATG
GAAGACTGCTGATTCCATGAGAATCATCTTCTCCCATGACATTAAAGTCCGGTGTAATATCATCCGGGAG
Reverse sequence
CATTCTTCTGCTTGGCTGCTGTTCTTCGTCTTCTTCAATGTCTTAAGCTGAGGTAGAGAGAGAAAGTGAGAGAGAGAAAGTGAGAGGGTT
TTGGTGATATTGACTGCATAGTTGCGCCATCTTATAATTAGAAGTTTCATGATGTATGTAGACACCCTTTTTTCTTAACCAACTAGAAAC
AAAACAAAGGAAAAATAATAACGAAGAAAAAAGAATGAGCTTATCAGGAAAAGGGACTCCAACCAGTGACAAAAAGCTAACCTTAGCAAA
AGCGACAAGCTTGAATCCAAATGCCGCAGAATTTGTACCCTTTGCACTCAGATCACCCTCAGGTAGCACTAGCAGCACCGATGCATCAAA
GTTCGCTAACTCCACTACTACTCTTGGAAAAGCTGTACTAGATAGATCAGAATCATCTGCTTCGAACAACTCAGATGATGAAGCACACCA
GTATTGGCGTCG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U144762340 (100.0% of RFLP seq)+
SGN-U1726632.2e-1248 (10.4% of RFLP seq)-
SGN-U1447626.3e-2252 (11.3% of RFLP seq)-
SGN-U144762376 (81.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51897)
Chromosome
8
Position
76.98 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43652)
Chromosome
8
Position
18.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43511)
Chromosome
8
Position
3.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43052)
Chromosome
8
Position
20.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7932)
Chromosome
8
Position
16.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT47 was used as an overgo probe on plate 12 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGGAGATAACTCCAGCTGGTCCTT
B sequence
CAGTGGCTTCATGTTGAAGGACCA
AB sequence
AGGAGATAACTCCAGCTGGTCCTTCAACAT
Marker sequence
CGTTATAATGAGGCCCCTCCCTAATATTGGCAAAGGGCTGGTCACTAGTC
AGCGATGGCTTGTCCCAGGGTTTAGAAGGCAGATGAAAACTAGTTGAGGA
TGCATCTTCGCCAAAAGATGTAATAGGATATCCTGTCTTTTCAACAAAAC
TAGTACCATTAATGCGATTAGGAGATAACTCCAGCTGGTCCTTCAACATG
AAGCCACTGCCAGTTGAGGCAGGGAATATTGAAGCTTCATTGACATCAGT
TACTGATAATCTAGAAAATGGAAGACTGCTGATTCCATGAGAATCATCTT
CTCCCATGACATTAAAGTCCGGTGTAATATCATCCGGGAG
Genomic location of CT47  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D65 marker 65
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)