SGN Marker TG160

SGN-M650

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1560
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG160 image not available
Forward sequence
not available
Reverse sequence
ACATACCTACATGCCTCAACAGATCCCCCTTTATAACCATCTAAGTAATGAACATCATGATCATGAACATCAAACTCAAAAAATAATGTT
ATTGCCATTGGTTCTTGATTTAGTTGTTCAGGTGTACCTGCACTTAGTTTTTATGACGAGCAGTCTAATCTTAATAATCAATTTAGACCA
CTCAAGATGGACAGAAACAAAGCACTTGATTTTGGAATAAGACTGAATGTAGCACATCATGCAAGGAACATGTATATAAACATCAAAAGC
AAATTAATTCTTGACTGCAACCAATTGTGCATACATGAGCACAGCAAAATACATGTTGGAGGTAGAATCTCGGCTAAGCTTTAAAAAGAT
TAGACATGAATTTTCCAAATCAATGATCATTAACTCATTAAGTTACCATTATCAAAAAAAGAATCATCATTAACTCATCCAGCTTTGGCG
GAAAAGGGAAAATGAAAAGTAAATAAAACAAAGGCTTACCTTTTACATGCAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9720)
Chromosome
8
Position
86.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG160 was used as an overgo probe on plate 12 [well E3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P038P21,   P075F17,   P300L10,   P270G11,   P004M03,   P233L05,   P329L01,   P154D03

 Overgo Sequences

A sequence
TGAGCACAGCAAAATACATGTTGG
B sequence
AGCCGAGATTCTACCTCCAACATG
AB sequence
TGAGCACAGCAAAATACATGTTGGAGGTAG
Marker sequence
ACATACCTACATGCCTCAACAGATCCCCCTTTATAACCATCTAAGTAATG
AACATCATGATCATGAACATCAAACTCAAAAAATAATGTTATTGCCATTG
GTTCTTGATTTAGTTGTTCAGGTGTACCTGCACTTAGTTTTTATGACGAG
CAGTCTAATCTTAATAATCAATTTAGACCACTCAAGATGGACAGAAACAA
AGCACTTGATTTTGGAATAAGACTGAATGTAGCACATCATGCAAGGAACA
TGTATATAAACATCAAAAGCAAATTAATTCTTGACTGCAACCAATTGTGC
ATACATGAGCACAGCAAAATACATGTTGGAGGTAGAATCTCGGCTAAGCT
TTAAAAAGATTAGACATGAATTTTCCAAATCAATGATCATTAACTCATTA
AGTTACCATTATCAAAAAAAGAATCATCATTAACTCATCCAGCTTTGGCG
GAAAAGGGAAAATGAAAAGTAAATAAAACAAAGGCTTACCTTTTACATGC
AT
Genomic location of TG160  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D650 marker 650
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)