SGN Marker CT84

SGN-M652

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT84 image not available
Forward sequence
not available
Reverse sequence
GTACCCAAGCCCATCAAATGGTGGACTTCATTGCTGATTACTACAAGAATATTGAGTCCTACCCGGTTCTAAGTCAAGTCGAACCCGGTT
ATCTTCGTACCCAATTACCCGAAAACGCCCCTAATCGACCCGAATCATTCGATTTAATTATGAAAGATGTCCAAAACCATATTATCCCGG
GTATGACCCATTGGCTAAGCCCGAATTTCTTCGCATTTTTTCCAGCTACTGTTAGCTCCGCTGCGTTTCTAGGTGAAATGCTTTGCAATT
GTTTCAACTCCGTCGGATTTAATTGGCTGGCTTCGCCAGCCATGACGGAGTTGGAAATGGTAGTCATGGACTGGCTTGCTAATACGTTGA
AATTACCAAAAACTTTCATGTTTTCTGGCACGGGTGGTGGTGTACTACAAAGTACAACTAGTGAAGCTATACTGTGTACGTTAATCGCTG
CGCGTGATCATAAGATCGAGAATATAGGTGTTGATGAGATAGGAAAATTTGTAGTCTACGGGTCTGATCAAAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51907)
Chromosome
7
Position
20.28 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42973)
Chromosome
7
Position
45.20 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43973
Forward primer (5'-3')
ATTACCCGAAAACGCCCCTA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GTCCCAACGGTAGCACAGAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42361)
Chromosome
7
Position
67.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39076)
Chromosome
7
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9727)
Chromosome
7
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9726)
Chromosome
7
Position
49.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT84 was used as an overgo probe on plate 8 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCTACCCGGTTCTAAGTCAAGTC
B sequence
GAAGATAACCGGGTTCGACTTGAC
AB sequence
TCCTACCCGGTTCTAAGTCAAGTCGAACCC
Marker sequence
GTACCCAAGCCCATCAAATGGTGGACTTCATTGCTGATTACTACAAGAAT
ATTGAGTCCTACCCGGTTCTAAGTCAAGTCGAACCCGGTTATCTTCGTAC
CCAATTACCCGAAAACGCCCCTAATCGACCCGAATCATTCGATTTAATTA
TGAAAGATGTCCAAAACCATATTATCCCGGGTATGACCCATTGGCTAAGC
CCGAATTTCTTCGCATTTTTTCCAGCTACTGTTAGCTCCGCTGCGTTTCT
AGGTGAAATGCTTTGCAATTGTTTCAACTCCGTCGGATTTAATTGGCTGG
CTTCGCCAGCCATGACGGAGTTGGAAATGGTAGTCATGGACTGGCTTGCT
AATACGTTGAAATTACCAAAAACTTTCATGTTTTCTGGCACGGGTGGTGG
TGTACTACAAAGTACAACTAGTGAAGCTATACTGTGTACGTTAATCGCTG
CGCGTGATCATAAGATCGAGAATATAGGTGTTGATGAGATAGGAAAATTT
GTAGTCTACGGGTCTGATCAAAC
Genomic location of CT84  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D652 marker 652
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)