SGN Marker CT85

SGN-M653

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT85 image not available
Forward sequence
not available
Reverse sequence
AAAGGACTTGGATATGCTTGTGGAGACGATAACATCGTGGATGTACTCTAACACTGGCCCAAAACTTTTACAATGATATATGCTAAAGAA
AATATATGTATATGAACCCTACTGAATGGCTCTGTAATTTGGCAATGATTGTATATACTTGATTGACATTTAGTACTCGTGTATAATAAT
GTGACT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1540688e-81186 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53752)
Chromosome
3
Position
91.80 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53479)
Chromosome
3
Position
66.26 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43659)
Chromosome
3
Position
89.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43517)
Chromosome
3
Position
78.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43059)
Chromosome
3
Position
80.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42362)
Chromosome
3
Position
122.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9732)
Chromosome
3
Position
132.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9731)
Chromosome
3
Position
83.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9733)
Chromosome
3
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT85 was used as an overgo probe on plate 4 [well A8]

Plausible BAC Matches:   P314B13,   P033D23,   P245C22,   P205J09,   P323M06,   P035G11,   P330E08,   P177C23,   P058I03,   P004G22

 Non-Plausible BAC matches

P240F10,   P265P22,   P124P11,   P215C08,   P319K21,   P125N10,   P006P01,   P026A12

 Overgo Sequences

A sequence
GAGACGATAACATCGTGGATGTAC
B sequence
TTGGGCCAGTGTTAGAGTACATCC
AB sequence
GAGACGATAACATCGTGGATGTACTCTAAC
Marker sequence
AAAGGACTTGGATATGCTTGTGGAGACGATAACATCGTGGATGTACTCTA
ACACTGGCCCAAAACTTTTACAATGATATATGCTAAAGAAAATATATGTA
TATGAACCCTACTGAATGGCTCTGTAATTTGGCAATGATTGTATATACTT
GATTGACATTTAGTACTCGTGTATAATAATGTGACT
Genomic location of CT85  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D653 marker 653
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)